Incidental Mutation 'R2211:Ddx51'
ID 239364
Institutional Source Beutler Lab
Gene Symbol Ddx51
Ensembl Gene ENSMUSG00000029504
Gene Name DEAD box helicase 51
Synonyms 2310061O04Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 51
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2211 (G1)
Quality Score 169
Status Not validated
Chromosome 5
Chromosomal Location 110801317-110808362 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110803634 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 343 (D343E)
Ref Sequence ENSEMBL: ENSMUSP00000031478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031478] [ENSMUST00000042147] [ENSMUST00000148773]
AlphaFold Q6P9R1
Predicted Effect probably damaging
Transcript: ENSMUST00000031478
AA Change: D343E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031478
Gene: ENSMUSG00000029504
AA Change: D343E

DomainStartEndE-ValueType
low complexity region 50 75 N/A INTRINSIC
DEXDc 189 442 4.04e-40 SMART
HELICc 491 573 2.86e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042147
SMART Domains Protein: ENSMUSP00000038263
Gene: ENSMUSG00000033294

DomainStartEndE-ValueType
Pfam:CBF 305 453 2.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150100
Predicted Effect probably benign
Transcript: ENSMUST00000148773
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Ddx51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Ddx51 APN 5 110,803,729 (GRCm39) missense probably benign 0.00
IGL01688:Ddx51 APN 5 110,803,513 (GRCm39) missense probably benign 0.37
IGL02993:Ddx51 APN 5 110,803,487 (GRCm39) missense possibly damaging 0.93
IGL03149:Ddx51 APN 5 110,801,600 (GRCm39) missense probably benign
R1659:Ddx51 UTSW 5 110,802,986 (GRCm39) missense probably damaging 0.99
R2036:Ddx51 UTSW 5 110,804,491 (GRCm39) missense probably benign 0.01
R4705:Ddx51 UTSW 5 110,803,174 (GRCm39) missense probably damaging 1.00
R5239:Ddx51 UTSW 5 110,801,514 (GRCm39) missense probably benign
R5255:Ddx51 UTSW 5 110,803,908 (GRCm39) missense possibly damaging 0.67
R5711:Ddx51 UTSW 5 110,802,790 (GRCm39) missense probably benign 0.03
R5966:Ddx51 UTSW 5 110,804,717 (GRCm39) missense probably damaging 1.00
R6970:Ddx51 UTSW 5 110,804,728 (GRCm39) missense probably damaging 1.00
R7374:Ddx51 UTSW 5 110,804,998 (GRCm39) missense probably damaging 1.00
R7664:Ddx51 UTSW 5 110,804,785 (GRCm39) critical splice donor site probably null
Z1176:Ddx51 UTSW 5 110,802,424 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGATGGTTTCCGTTGCCTG -3'
(R):5'- TGTTATAGACAGGGCCAGCCAG -3'

Sequencing Primer
(F):5'- TTGCCTGGCCGACATTG -3'
(R):5'- CTGAGAAAGAGAGCAGCACCTG -3'
Posted On 2014-10-15