Mutagenetix > Incidental Mutation

Incidental Mutation 'R2211:Cftr'

239366

Institutional Source

Beutler Lab

Gene Symbol

Cftr

Ensembl Gene

ENSMUSG00000041301

Gene Name

cystic fibrosis transmembrane conductance regulator

Synonyms

Abcc7

MMRRC Submission

040213-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R2211 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18170687-18322768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18214280 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 152 (M152V)

Ref Sequence

ENSEMBL: ENSMUSP00000115334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]

AlphaFold

P26361

Predicted Effect

probably null
Transcript: ENSMUST00000045706
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: M152V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.7e-40	PFAM
AAA	450	623	2.16e-12	SMART
Pfam:CFTR_R	639	844	2e-93	PFAM
Pfam:ABC_membrane	857	1142	2.7e-53	PFAM
AAA	1232	1414	9.94e-12	SMART
low complexity region	1465	1474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115405
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: M152V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.4e-48	PFAM
Pfam:ABC_tran	441	570	2.3e-19	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000115406
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: M152V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115406
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: M152V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000129452
AA Change: M152V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: M152V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.9e-39	PFAM
Pfam:ABC_tran	441	528	5.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140407
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: M152V

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.2e-48	PFAM
Pfam:ABC_tran	441	568	6.3e-20	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430078G23Rik	T	C	8: 3,387,680	S268P	possibly damaging	Het
Adam18	A	G	8: 24,628,155	S34P	probably damaging	Het
Adam23	T	A	1: 63,573,129		probably benign	Het
Adcy10	A	T	1: 165,518,212	I277F	probably damaging	Het
Arfgef3	A	T	10: 18,592,245	S1736T	possibly damaging	Het
Arhgap21	A	T	2: 20,881,640	M242K	possibly damaging	Het
Astn1	A	G	1: 158,657,306	R4G	probably benign	Het
AU041133	G	A	10: 82,150,921	C135Y	probably damaging	Het
Cdc42bpb	A	G	12: 111,301,854	V53A	probably benign	Het
Cdh23	T	C	10: 60,466,004	D428G	possibly damaging	Het
Cebpa	T	C	7: 35,120,466	S350P	probably damaging	Het
Cpa4	A	G	6: 30,583,650	N255S	possibly damaging	Het
Ddx51	T	A	5: 110,655,768	D343E	probably damaging	Het
Dnah7a	T	C	1: 53,479,773	I2942V	probably benign	Het
Dnajc1	G	T	2: 18,392,475	A9E	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Edem3	A	G	1: 151,804,702	D526G	possibly damaging	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Etaa1	G	A	11: 17,952,686	Q84*	probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam149a	G	A	8: 45,341,009	T674I	probably damaging	Het
Fam98a	A	G	17: 75,538,945		probably null	Het
Fat4	A	G	3: 38,891,527	N1523S	possibly damaging	Het
Fbxw10	A	G	11: 62,867,535	T529A	probably damaging	Het
Gzf1	C	T	2: 148,684,950	A447V	probably damaging	Het
Hap1	G	A	11: 100,354,724	T138M	probably benign	Het
Hic1	T	A	11: 75,169,384	R46W	possibly damaging	Het
Id4	T	A	13: 48,261,802	L102Q	probably damaging	Het
Il3ra	T	C	14: 14,355,029	C271R	probably benign	Het
Ints4	T	C	7: 97,509,750	I443T	possibly damaging	Het
Lmln	A	G	16: 33,109,778	E535G	probably benign	Het
Lrrtm4	A	G	6: 80,022,640	H345R	probably benign	Het
Ltbp3	T	C	19: 5,753,962	I834T	possibly damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Mpp5	A	T	12: 78,797,248	K75N	possibly damaging	Het
Ms4a18	C	A	19: 10,997,305	V341L	probably benign	Het
Nbr1	T	C	11: 101,567,264		probably null	Het
Nf1	T	C	11: 79,444,064	M914T	probably benign	Het
Notch3	T	A	17: 32,147,978	H861L	probably benign	Het
Nupl1	A	G	14: 60,232,640	F341L	probably damaging	Het
Ogfod2	C	A	5: 124,112,780		probably null	Het
Oit3	T	C	10: 59,428,070	D414G	probably damaging	Het
Olfr1079	T	C	2: 86,538,513	Y132C	probably damaging	Het
Olfr1497	T	A	19: 13,795,369	M81L	probably benign	Het
Olfr787	A	T	10: 129,462,940	K88M	probably damaging	Het
Olfr804	A	G	10: 129,705,451	H191R	probably benign	Het
Pcbp4	C	A	9: 106,460,734	H74Q	probably benign	Het
Pip5k1b	A	T	19: 24,378,850	D241E	probably damaging	Het
Plcb2	T	C	2: 118,723,534	D102G	probably benign	Het
Plekha5	G	A	6: 140,525,861	E4K	possibly damaging	Het
Ppargc1a	A	C	5: 51,474,259	S343A	possibly damaging	Het
Ppwd1	G	A	13: 104,207,142	S585L	probably benign	Het
Rarg	T	C	15: 102,239,524	N284S	probably benign	Het
Rnpepl1	C	T	1: 92,916,380	L278F	probably damaging	Het
Rp1	A	C	1: 4,348,139	S917A	probably damaging	Het
Rsf1	ATGGCG	ATGGCGAGGGTGGCG	7: 97,579,904		probably benign	Het
Rsph3b	T	C	17: 6,941,740	S189G	probably benign	Het
Sec31b	A	T	19: 44,523,150	L604Q	probably damaging	Het
Sema6b	T	A	17: 56,124,741	I641F	probably benign	Het
Slc35f5	A	T	1: 125,579,264	I309F	possibly damaging	Het
Smarca4	A	G	9: 21,686,029	E1360G	probably damaging	Het
Spata31d1c	T	C	13: 65,035,939	S432P	probably benign	Het
Spsb3	T	C	17: 24,890,937		probably null	Het
Sptbn4	T	C	7: 27,367,609	D1960G	probably damaging	Het
Srgap1	A	G	10: 121,853,740	V345A	possibly damaging	Het
Tiam2	C	A	17: 3,414,918	C307*	probably null	Het
Trim43b	T	A	9: 89,085,249	T444S	possibly damaging	Het
Trmt13	A	G	3: 116,594,754	I11T	probably benign	Het
Ylpm1	A	T	12: 85,044,378	R1073*	probably null	Het
Zfp524	T	C	7: 5,017,919	S149P	probably damaging	Het
Zfp777	T	C	6: 48,043,885	I312V	possibly damaging	Het

Other mutations in Cftr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Cftr	APN	6	18268430	critical splice donor site	probably null
IGL01082:Cftr	APN	6	18226103	missense	probably damaging	0.97
IGL01113:Cftr	APN	6	18270253	missense	probably damaging	1.00
IGL01383:Cftr	APN	6	18226041	missense	probably benign	0.00
IGL01595:Cftr	APN	6	18198239	splice site	probably benign
IGL01820:Cftr	APN	6	18226139	missense	probably damaging	1.00
IGL02223:Cftr	APN	6	18221482	missense	probably damaging	1.00
IGL02249:Cftr	APN	6	18277871	missense	possibly damaging	0.58
IGL02439:Cftr	APN	6	18258238	nonsense	probably null
IGL02537:Cftr	APN	6	18274597	missense	probably benign	0.31
IGL03234:Cftr	APN	6	18225988	missense	probably damaging	0.96
BB004:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
BB014:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
PIT4453001:Cftr	UTSW	6	18214106	missense	probably damaging	0.99
PIT4520001:Cftr	UTSW	6	18277843	missense	probably benign	0.01
R0114:Cftr	UTSW	6	18282448	missense	probably damaging	1.00
R0329:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0330:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0331:Cftr	UTSW	6	18235226	missense	possibly damaging	0.72
R0480:Cftr	UTSW	6	18274518	splice site	probably benign
R0612:Cftr	UTSW	6	18198126	missense	probably benign	0.01
R0633:Cftr	UTSW	6	18305980	missense	probably damaging	0.99
R0830:Cftr	UTSW	6	18270225	missense	probably benign	0.02
R1559:Cftr	UTSW	6	18225937	missense	probably benign	0.01
R1629:Cftr	UTSW	6	18226106	missense	probably damaging	1.00
R1636:Cftr	UTSW	6	18226157	missense	probably damaging	0.99
R1860:Cftr	UTSW	6	18268289	missense	probably benign	0.00
R2043:Cftr	UTSW	6	18320935	missense	probably benign
R4737:Cftr	UTSW	6	18299883	missense	probably benign	0.19
R4793:Cftr	UTSW	6	18226088	missense	probably damaging	1.00
R4857:Cftr	UTSW	6	18320975	missense	possibly damaging	0.92
R4984:Cftr	UTSW	6	18235199	missense	possibly damaging	0.89
R4999:Cftr	UTSW	6	18221614	missense	probably benign	0.17
R5045:Cftr	UTSW	6	18230081	missense	probably benign	0.20
R5183:Cftr	UTSW	6	18299833	missense	probably damaging	0.99
R5197:Cftr	UTSW	6	18255414	missense	probably benign	0.00
R5288:Cftr	UTSW	6	18226129	nonsense	probably null
R5337:Cftr	UTSW	6	18319059	missense	probably damaging	1.00
R5549:Cftr	UTSW	6	18227954	missense	probably benign	0.00
R5596:Cftr	UTSW	6	18268096	missense	probably benign	0.00
R5651:Cftr	UTSW	6	18255365	splice site	probably null
R5660:Cftr	UTSW	6	18313687	missense	probably benign	0.22
R5941:Cftr	UTSW	6	18313646	missense	probably damaging	1.00
R6221:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6222:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6229:Cftr	UTSW	6	18220684	missense	probably damaging	1.00
R6256:Cftr	UTSW	6	18274661	missense	probably damaging	0.96
R6257:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6412:Cftr	UTSW	6	18285604	missense	probably damaging	0.97
R6459:Cftr	UTSW	6	18258236	missense	probably damaging	1.00
R6558:Cftr	UTSW	6	18222528	missense	probably damaging	1.00
R6724:Cftr	UTSW	6	18255974	nonsense	probably null
R6787:Cftr	UTSW	6	18274608	nonsense	probably null
R6861:Cftr	UTSW	6	18268108	missense	probably benign	0.00
R6888:Cftr	UTSW	6	18313730	critical splice donor site	probably null
R7084:Cftr	UTSW	6	18226138	missense	probably benign	0.17
R7105:Cftr	UTSW	6	18318972	missense	probably damaging	1.00
R7320:Cftr	UTSW	6	18319013	missense	probably damaging	0.97
R7359:Cftr	UTSW	6	18221624	missense	probably benign	0.00
R7466:Cftr	UTSW	6	18227973	missense	probably benign
R7502:Cftr	UTSW	6	18214296	missense	probably damaging	1.00
R7748:Cftr	UTSW	6	18277889	critical splice donor site	probably null
R7808:Cftr	UTSW	6	18204205	missense	probably benign
R7817:Cftr	UTSW	6	18267968	missense	probably damaging	0.97
R7927:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
R7968:Cftr	UTSW	6	18226049	missense	probably benign	0.00
R7995:Cftr	UTSW	6	18214156	missense	probably damaging	1.00
R8171:Cftr	UTSW	6	18258288	missense	probably damaging	1.00
R8210:Cftr	UTSW	6	18220697	missense	probably damaging	1.00
R8548:Cftr	UTSW	6	18273699	missense	possibly damaging	0.87
R8712:Cftr	UTSW	6	18274697	missense	probably damaging	0.99
R8737:Cftr	UTSW	6	18319729	missense	probably damaging	1.00
R8926:Cftr	UTSW	6	18268004	missense	possibly damaging	0.83
R8979:Cftr	UTSW	6	18227948	missense	probably benign	0.10
R8996:Cftr	UTSW	6	18255946	nonsense	probably null
R9087:Cftr	UTSW	6	18214181	missense	possibly damaging	0.91
R9115:Cftr	UTSW	6	18235311	missense	probably damaging	1.00
R9406:Cftr	UTSW	6	18299867	missense	probably benign	0.00
R9689:Cftr	UTSW	6	18313650	missense	probably damaging	0.99
R9700:Cftr	UTSW	6	18268360	missense	probably damaging	1.00
R9747:Cftr	UTSW	6	18285637	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- TCTCCTGCAGGAAGTCACCAAG -3'
(R):5'- TTCTTGTACAAGCTCACATTTAGGG -3'

Sequencing Primer
(F):5'- GAAGTCACCAAGGCTGTCCAG -3'
(R):5'- AGCTCACATTTAGGGCACTG -3'

Posted On

2014-10-15