Incidental Mutation 'R2211:Cftr'
ID239366
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Namecystic fibrosis transmembrane conductance regulator
SynonymsAbcc7
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location18170687-18322768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18214280 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 152 (M152V)
Ref Sequence ENSEMBL: ENSMUSP00000115334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]
Predicted Effect probably null
Transcript: ENSMUST00000045706
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: M152V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115405
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: M152V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115406
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: M152V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115406
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: M152V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129452
AA Change: M152V

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: M152V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.9e-39 PFAM
Pfam:ABC_tran 441 528 5.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140407
AA Change: M152V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: M152V

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18268430 critical splice donor site probably null
IGL01082:Cftr APN 6 18226103 missense probably damaging 0.97
IGL01113:Cftr APN 6 18270253 missense probably damaging 1.00
IGL01383:Cftr APN 6 18226041 missense probably benign 0.00
IGL01595:Cftr APN 6 18198239 splice site probably benign
IGL01820:Cftr APN 6 18226139 missense probably damaging 1.00
IGL02223:Cftr APN 6 18221482 missense probably damaging 1.00
IGL02249:Cftr APN 6 18277871 missense possibly damaging 0.58
IGL02439:Cftr APN 6 18258238 nonsense probably null
IGL02537:Cftr APN 6 18274597 missense probably benign 0.31
IGL03234:Cftr APN 6 18225988 missense probably damaging 0.96
BB004:Cftr UTSW 6 18267971 missense possibly damaging 0.81
BB014:Cftr UTSW 6 18267971 missense possibly damaging 0.81
PIT4453001:Cftr UTSW 6 18214106 missense probably damaging 0.99
PIT4520001:Cftr UTSW 6 18277843 missense probably benign 0.01
R0114:Cftr UTSW 6 18282448 missense probably damaging 1.00
R0329:Cftr UTSW 6 18226097 missense probably null 1.00
R0330:Cftr UTSW 6 18226097 missense probably null 1.00
R0331:Cftr UTSW 6 18235226 missense possibly damaging 0.72
R0480:Cftr UTSW 6 18274518 splice site probably benign
R0612:Cftr UTSW 6 18198126 missense probably benign 0.01
R0633:Cftr UTSW 6 18305980 missense probably damaging 0.99
R0830:Cftr UTSW 6 18270225 missense probably benign 0.02
R1559:Cftr UTSW 6 18225937 missense probably benign 0.01
R1629:Cftr UTSW 6 18226106 missense probably damaging 1.00
R1636:Cftr UTSW 6 18226157 missense probably damaging 0.99
R1860:Cftr UTSW 6 18268289 missense probably benign 0.00
R2043:Cftr UTSW 6 18320935 missense probably benign
R4737:Cftr UTSW 6 18299883 missense probably benign 0.19
R4793:Cftr UTSW 6 18226088 missense probably damaging 1.00
R4857:Cftr UTSW 6 18320975 missense possibly damaging 0.92
R4984:Cftr UTSW 6 18235199 missense possibly damaging 0.89
R4999:Cftr UTSW 6 18221614 missense probably benign 0.17
R5045:Cftr UTSW 6 18230081 missense probably benign 0.20
R5183:Cftr UTSW 6 18299833 missense probably damaging 0.99
R5197:Cftr UTSW 6 18255414 missense probably benign 0.00
R5288:Cftr UTSW 6 18226129 nonsense probably null
R5337:Cftr UTSW 6 18319059 missense probably damaging 1.00
R5549:Cftr UTSW 6 18227954 missense probably benign 0.00
R5596:Cftr UTSW 6 18268096 missense probably benign 0.00
R5651:Cftr UTSW 6 18255365 splice site probably null
R5660:Cftr UTSW 6 18313687 missense probably benign 0.22
R5941:Cftr UTSW 6 18313646 missense probably damaging 1.00
R6221:Cftr UTSW 6 18282501 missense probably benign 0.00
R6222:Cftr UTSW 6 18282501 missense probably benign 0.00
R6229:Cftr UTSW 6 18220684 missense probably damaging 1.00
R6256:Cftr UTSW 6 18274661 missense probably damaging 0.96
R6257:Cftr UTSW 6 18282501 missense probably benign 0.00
R6412:Cftr UTSW 6 18285604 missense probably damaging 0.97
R6459:Cftr UTSW 6 18258236 missense probably damaging 1.00
R6558:Cftr UTSW 6 18222528 missense probably damaging 1.00
R6724:Cftr UTSW 6 18255974 nonsense probably null
R6787:Cftr UTSW 6 18274608 nonsense probably null
R6861:Cftr UTSW 6 18268108 missense probably benign 0.00
R6888:Cftr UTSW 6 18313730 critical splice donor site probably null
R7084:Cftr UTSW 6 18226138 missense probably benign 0.17
R7105:Cftr UTSW 6 18318972 missense probably damaging 1.00
R7320:Cftr UTSW 6 18319013 missense probably damaging 0.97
R7359:Cftr UTSW 6 18221624 missense probably benign 0.00
R7466:Cftr UTSW 6 18227973 missense probably benign
R7502:Cftr UTSW 6 18214296 missense probably damaging 1.00
R7748:Cftr UTSW 6 18277889 critical splice donor site probably null
R7808:Cftr UTSW 6 18204205 missense probably benign
R7817:Cftr UTSW 6 18267968 missense probably damaging 0.97
R7927:Cftr UTSW 6 18267971 missense possibly damaging 0.81
R7968:Cftr UTSW 6 18226049 missense probably benign 0.00
R7995:Cftr UTSW 6 18214156 missense probably damaging 1.00
R8171:Cftr UTSW 6 18258288 missense probably damaging 1.00
R8210:Cftr UTSW 6 18220697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGCAGGAAGTCACCAAG -3'
(R):5'- TTCTTGTACAAGCTCACATTTAGGG -3'

Sequencing Primer
(F):5'- GAAGTCACCAAGGCTGTCCAG -3'
(R):5'- AGCTCACATTTAGGGCACTG -3'
Posted On2014-10-15