Incidental Mutation 'R2211:Lrrtm4'
ID 239369
Institutional Source Beutler Lab
Gene Symbol Lrrtm4
Ensembl Gene ENSMUSG00000052581
Gene Name leucine rich repeat transmembrane neuronal 4
Synonyms 7530419J18Rik
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R2211 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 79995860-80787124 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79999623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 345 (H345R)
Ref Sequence ENSEMBL: ENSMUSP00000117263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074662] [ENSMUST00000126005] [ENSMUST00000126399] [ENSMUST00000128718] [ENSMUST00000133918] [ENSMUST00000136421] [ENSMUST00000145407] [ENSMUST00000147663]
AlphaFold Q80XG9
Predicted Effect probably benign
Transcript: ENSMUST00000074662
AA Change: H344R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074232
Gene: ENSMUSG00000052581
AA Change: H344R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 4e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126005
AA Change: H344R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117445
Gene: ENSMUSG00000052581
AA Change: H344R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 4e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126399
AA Change: H344R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121124
Gene: ENSMUSG00000052581
AA Change: H344R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 2e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130734
Predicted Effect probably benign
Transcript: ENSMUST00000133918
AA Change: H344R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115016
Gene: ENSMUSG00000052581
AA Change: H344R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
LRR_TYP 84 107 6.67e-2 SMART
LRR 108 131 3.52e-1 SMART
LRR_TYP 132 155 2.53e-2 SMART
LRR 156 179 1.16e-1 SMART
LRR 180 203 4.34e-1 SMART
LRR 204 224 2.4e1 SMART
LRR 228 251 4.97e0 SMART
LRR 252 275 1.07e0 SMART
LRR 276 299 1.64e-1 SMART
Blast:LRRCT 311 361 2e-25 BLAST
low complexity region 375 392 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
low complexity region 464 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136421
AA Change: H345R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121621
Gene: ENSMUSG00000052581
AA Change: H345R

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 34 66 1.66e0 SMART
LRR_TYP 85 108 6.67e-2 SMART
LRR 109 132 3.52e-1 SMART
LRR_TYP 133 156 2.53e-2 SMART
LRR 157 180 1.16e-1 SMART
LRR 181 204 4.34e-1 SMART
LRR 205 225 2.4e1 SMART
LRR 229 252 4.97e0 SMART
LRR 253 276 1.07e0 SMART
LRR 277 300 1.64e-1 SMART
Blast:LRRCT 312 362 4e-25 BLAST
low complexity region 376 393 N/A INTRINSIC
transmembrane domain 426 448 N/A INTRINSIC
low complexity region 465 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145407
SMART Domains Protein: ENSMUSP00000114465
Gene: ENSMUSG00000052581

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LRRNT 33 65 1.66e0 SMART
Blast:LRR_TYP 84 104 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147663
AA Change: H345R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000117263
Gene: ENSMUSG00000052581
AA Change: H345R

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 34 66 1.66e0 SMART
LRR_TYP 85 108 6.67e-2 SMART
LRR 109 132 3.52e-1 SMART
LRR_TYP 133 156 2.53e-2 SMART
LRR 157 180 1.16e-1 SMART
LRR 181 204 4.34e-1 SMART
LRR 205 225 2.4e1 SMART
LRR 229 252 4.97e0 SMART
LRR 253 276 1.07e0 SMART
LRR 277 300 1.64e-1 SMART
Blast:LRRCT 312 362 2e-25 BLAST
low complexity region 376 393 N/A INTRINSIC
transmembrane domain 426 448 N/A INTRINSIC
low complexity region 465 470 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired excitatory synapse development and excitatory transmission in dentate gyrus granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Lrrtm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Lrrtm4 APN 6 79,999,529 (GRCm39) missense probably damaging 1.00
IGL02043:Lrrtm4 APN 6 79,998,845 (GRCm39) missense possibly damaging 0.89
IGL02603:Lrrtm4 APN 6 79,999,967 (GRCm39) missense possibly damaging 0.92
IGL02614:Lrrtm4 APN 6 79,998,827 (GRCm39) missense probably benign 0.01
IGL02735:Lrrtm4 APN 6 80,786,031 (GRCm39) missense probably benign
IGL02812:Lrrtm4 APN 6 79,998,947 (GRCm39) missense probably damaging 1.00
IGL02885:Lrrtm4 APN 6 79,998,786 (GRCm39) missense probably damaging 1.00
IGL02956:Lrrtm4 APN 6 79,998,633 (GRCm39) missense probably benign 0.04
IGL03242:Lrrtm4 APN 6 79,999,071 (GRCm39) missense probably benign 0.22
R0504:Lrrtm4 UTSW 6 79,999,029 (GRCm39) missense probably damaging 1.00
R0537:Lrrtm4 UTSW 6 79,999,103 (GRCm39) missense probably benign 0.02
R0656:Lrrtm4 UTSW 6 79,998,953 (GRCm39) missense possibly damaging 0.87
R0698:Lrrtm4 UTSW 6 79,999,911 (GRCm39) missense probably damaging 1.00
R1651:Lrrtm4 UTSW 6 79,999,511 (GRCm39) missense probably benign 0.06
R2126:Lrrtm4 UTSW 6 79,998,722 (GRCm39) missense probably damaging 1.00
R2363:Lrrtm4 UTSW 6 79,998,857 (GRCm39) missense probably damaging 1.00
R3732:Lrrtm4 UTSW 6 79,996,638 (GRCm39) intron probably benign
R3817:Lrrtm4 UTSW 6 79,999,044 (GRCm39) missense probably benign 0.00
R4814:Lrrtm4 UTSW 6 80,000,117 (GRCm39) missense possibly damaging 0.69
R5304:Lrrtm4 UTSW 6 79,999,683 (GRCm39) missense probably benign 0.01
R5318:Lrrtm4 UTSW 6 79,999,495 (GRCm39) missense probably damaging 1.00
R5327:Lrrtm4 UTSW 6 79,999,620 (GRCm39) missense probably damaging 1.00
R5931:Lrrtm4 UTSW 6 79,998,722 (GRCm39) missense probably damaging 0.99
R6195:Lrrtm4 UTSW 6 79,998,939 (GRCm39) missense probably damaging 1.00
R7597:Lrrtm4 UTSW 6 79,999,428 (GRCm39) nonsense probably null
R7793:Lrrtm4 UTSW 6 79,999,841 (GRCm39) missense probably damaging 0.97
R7875:Lrrtm4 UTSW 6 79,999,343 (GRCm39) missense possibly damaging 0.89
R8058:Lrrtm4 UTSW 6 79,999,528 (GRCm39) missense probably benign
R8238:Lrrtm4 UTSW 6 79,999,668 (GRCm39) missense probably damaging 0.97
R8324:Lrrtm4 UTSW 6 79,998,974 (GRCm39) missense probably damaging 1.00
R8751:Lrrtm4 UTSW 6 79,999,092 (GRCm39) missense probably damaging 1.00
R8859:Lrrtm4 UTSW 6 79,998,870 (GRCm39) missense probably damaging 1.00
R9142:Lrrtm4 UTSW 6 79,999,426 (GRCm39) missense probably damaging 1.00
R9633:Lrrtm4 UTSW 6 80,000,064 (GRCm39) missense probably damaging 1.00
R9709:Lrrtm4 UTSW 6 80,786,154 (GRCm39) missense probably damaging 0.96
Z1177:Lrrtm4 UTSW 6 79,999,700 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTTGGATTCCAACAAGCTCACC -3'
(R):5'- CGTACTCATGATCCGTACCTGG -3'

Sequencing Primer
(F):5'- GCTCACCAATGTCTCCCAGGAG -3'
(R):5'- GATCCGTACCTGGAATTTGAAAGCC -3'
Posted On 2014-10-15