Incidental Mutation 'R2211:Fam149a'
ID 239381
Institutional Source Beutler Lab
Gene Symbol Fam149a
Ensembl Gene ENSMUSG00000070044
Gene Name family with sequence similarity 149, member A
Synonyms
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2211 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 45789754-45835328 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45794046 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 674 (T674I)
Ref Sequence ENSEMBL: ENSMUSP00000114612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093526] [ENSMUST00000155230]
AlphaFold Q8CFV2
Predicted Effect possibly damaging
Transcript: ENSMUST00000093526
AA Change: T755I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091245
Gene: ENSMUSG00000070044
AA Change: T755I

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
Pfam:DUF3719 305 370 4.3e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000135912
AA Change: T711I
SMART Domains Protein: ENSMUSP00000120196
Gene: ENSMUSG00000070044
AA Change: T711I

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 90 108 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
Pfam:DUF3719 259 324 2.7e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155230
AA Change: T674I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114612
Gene: ENSMUSG00000070044
AA Change: T674I

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 55 73 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
Pfam:DUF3719 224 291 5.8e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Fam149a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Fam149a APN 8 45,792,380 (GRCm39) missense probably damaging 1.00
IGL00229:Fam149a APN 8 45,804,823 (GRCm39) missense probably damaging 0.98
IGL01089:Fam149a APN 8 45,801,564 (GRCm39) missense possibly damaging 0.95
IGL01578:Fam149a APN 8 45,803,479 (GRCm39) missense probably damaging 1.00
IGL03095:Fam149a APN 8 45,794,265 (GRCm39) missense probably damaging 1.00
IGL03112:Fam149a APN 8 45,801,580 (GRCm39) missense possibly damaging 0.78
guangxi UTSW 8 45,834,778 (GRCm39) missense probably damaging 1.00
PIT1430001:Fam149a UTSW 8 45,804,743 (GRCm39) missense probably benign 0.00
R0111:Fam149a UTSW 8 45,794,183 (GRCm39) splice site probably benign
R0113:Fam149a UTSW 8 45,794,061 (GRCm39) missense probably damaging 1.00
R0452:Fam149a UTSW 8 45,808,686 (GRCm39) missense probably damaging 1.00
R0604:Fam149a UTSW 8 45,798,045 (GRCm39) missense probably damaging 1.00
R1441:Fam149a UTSW 8 45,808,684 (GRCm39) missense probably damaging 1.00
R1672:Fam149a UTSW 8 45,792,411 (GRCm39) critical splice acceptor site probably null
R1861:Fam149a UTSW 8 45,792,399 (GRCm39) nonsense probably null
R1981:Fam149a UTSW 8 45,834,778 (GRCm39) missense probably damaging 1.00
R2173:Fam149a UTSW 8 45,806,991 (GRCm39) missense probably damaging 1.00
R3807:Fam149a UTSW 8 45,834,647 (GRCm39) missense possibly damaging 0.91
R4176:Fam149a UTSW 8 45,794,321 (GRCm39) missense probably benign 0.41
R4913:Fam149a UTSW 8 45,806,920 (GRCm39) missense probably damaging 1.00
R5158:Fam149a UTSW 8 45,803,472 (GRCm39) missense possibly damaging 0.51
R5172:Fam149a UTSW 8 45,797,690 (GRCm39) missense probably damaging 0.99
R5436:Fam149a UTSW 8 45,801,508 (GRCm39) missense probably benign 0.21
R6060:Fam149a UTSW 8 45,811,799 (GRCm39) intron probably benign
R6426:Fam149a UTSW 8 45,834,611 (GRCm39) missense probably benign
R6590:Fam149a UTSW 8 45,802,071 (GRCm39) missense probably damaging 1.00
R6596:Fam149a UTSW 8 45,834,667 (GRCm39) missense probably benign 0.25
R6690:Fam149a UTSW 8 45,802,071 (GRCm39) missense probably damaging 1.00
R6730:Fam149a UTSW 8 45,834,211 (GRCm39) missense probably damaging 1.00
R6734:Fam149a UTSW 8 45,834,478 (GRCm39) missense probably benign
R6916:Fam149a UTSW 8 45,803,443 (GRCm39) missense probably damaging 1.00
R7088:Fam149a UTSW 8 45,803,582 (GRCm39) missense probably benign 0.08
R7219:Fam149a UTSW 8 45,803,600 (GRCm39) missense possibly damaging 0.94
R7352:Fam149a UTSW 8 45,794,034 (GRCm39) missense probably damaging 0.98
R7454:Fam149a UTSW 8 45,801,583 (GRCm39) missense probably benign 0.29
R7591:Fam149a UTSW 8 45,803,472 (GRCm39) missense possibly damaging 0.89
R7788:Fam149a UTSW 8 45,834,554 (GRCm39) missense probably damaging 1.00
R7846:Fam149a UTSW 8 45,811,678 (GRCm39) missense
R7915:Fam149a UTSW 8 45,794,280 (GRCm39) missense probably benign
R8036:Fam149a UTSW 8 45,802,048 (GRCm39) missense probably benign 0.00
R8181:Fam149a UTSW 8 45,834,755 (GRCm39) missense possibly damaging 0.92
R8239:Fam149a UTSW 8 45,803,490 (GRCm39) missense possibly damaging 0.48
R8246:Fam149a UTSW 8 45,834,655 (GRCm39) missense probably benign 0.00
R8532:Fam149a UTSW 8 45,801,991 (GRCm39) missense possibly damaging 0.80
R8856:Fam149a UTSW 8 45,834,611 (GRCm39) missense
R8986:Fam149a UTSW 8 45,811,837 (GRCm39) missense
R9448:Fam149a UTSW 8 45,792,411 (GRCm39) critical splice acceptor site probably null
R9704:Fam149a UTSW 8 45,795,502 (GRCm39) missense probably benign 0.24
R9794:Fam149a UTSW 8 45,834,449 (GRCm39) missense possibly damaging 0.47
Z1176:Fam149a UTSW 8 45,795,495 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCACATAGCACCATTGTGAGC -3'
(R):5'- GAACAGCTTTCAAGGCCCAG -3'

Sequencing Primer
(F):5'- ACATAGCACCATTGTGAGCTCTCTC -3'
(R):5'- GCTTTCAAGGCCCAGCACAAC -3'
Posted On 2014-10-15