Incidental Mutation 'R2211:AU041133'
ID239389
Institutional Source Beutler Lab
Gene Symbol AU041133
Ensembl Gene ENSMUSG00000078435
Gene Nameexpressed sequence AU041133
Synonyms
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82128013-82153065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82150921 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 135 (C135Y)
Ref Sequence ENSEMBL: ENSMUSP00000100951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105314] [ENSMUST00000201286]
Predicted Effect probably damaging
Transcript: ENSMUST00000105314
AA Change: C135Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100951
Gene: ENSMUSG00000078435
AA Change: C135Y

DomainStartEndE-ValueType
KRAB 3 65 1.77e-15 SMART
ZnF_C2H2 105 127 1.16e-1 SMART
ZnF_C2H2 133 155 3.26e-5 SMART
ZnF_C2H2 161 183 1.26e-2 SMART
ZnF_C2H2 189 211 7.37e-4 SMART
ZnF_C2H2 217 239 3.39e-3 SMART
ZnF_C2H2 245 267 1.26e-2 SMART
ZnF_C2H2 273 295 4.79e-3 SMART
ZnF_C2H2 301 323 6.99e-5 SMART
ZnF_C2H2 329 351 5.9e-3 SMART
ZnF_C2H2 357 379 1.03e-2 SMART
ZnF_C2H2 385 407 6.42e-4 SMART
ZnF_C2H2 413 435 8.94e-3 SMART
ZnF_C2H2 441 463 1.6e-4 SMART
ZnF_C2H2 469 491 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201286
AA Change: C136Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144661
Gene: ENSMUSG00000078435
AA Change: C136Y

DomainStartEndE-ValueType
KRAB 4 66 7.7e-18 SMART
ZnF_C2H2 106 128 5e-4 SMART
ZnF_C2H2 134 156 1.4e-7 SMART
ZnF_C2H2 162 184 5.3e-5 SMART
ZnF_C2H2 190 212 3.2e-6 SMART
ZnF_C2H2 218 240 1.4e-5 SMART
ZnF_C2H2 246 268 5.3e-5 SMART
ZnF_C2H2 274 296 2e-5 SMART
ZnF_C2H2 302 324 3.1e-7 SMART
ZnF_C2H2 330 352 2.6e-5 SMART
ZnF_C2H2 358 380 4.5e-5 SMART
ZnF_C2H2 386 408 2.8e-6 SMART
ZnF_C2H2 414 436 3.9e-5 SMART
ZnF_C2H2 442 464 7e-7 SMART
ZnF_C2H2 470 492 2.5e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in AU041133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03403:AU041133 APN 10 82138344 missense probably damaging 1.00
R0755:AU041133 UTSW 10 82150890 nonsense probably null
R1924:AU041133 UTSW 10 82151267 nonsense probably null
R2400:AU041133 UTSW 10 82150908 nonsense probably null
R3845:AU041133 UTSW 10 82151318 missense probably damaging 1.00
R3914:AU041133 UTSW 10 82151815 missense probably damaging 0.99
R4214:AU041133 UTSW 10 82151389 missense probably damaging 1.00
R4414:AU041133 UTSW 10 82151482 missense probably damaging 1.00
R5315:AU041133 UTSW 10 82151672 nonsense probably null
R5835:AU041133 UTSW 10 82151212 missense probably damaging 1.00
R6258:AU041133 UTSW 10 82151158 missense probably damaging 1.00
R6877:AU041133 UTSW 10 82151571 missense probably benign 0.24
R7127:AU041133 UTSW 10 82150866 missense probably benign 0.14
R7200:AU041133 UTSW 10 82151101 missense possibly damaging 0.94
R7228:AU041133 UTSW 10 82151271 missense possibly damaging 0.93
R7828:AU041133 UTSW 10 82151220 missense probably damaging 1.00
R8198:AU041133 UTSW 10 82151415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTTATTGCTGTGGAAACATCT -3'
(R):5'- TGCAAAGGCTTTACCACATTGG -3'

Sequencing Primer
(F):5'- TCTCTATAGCACATGTCAAGGGG -3'
(R):5'- CCACATTGGTTACATCCATAGGG -3'
Posted On2014-10-15