Incidental Mutation 'R2211:Or6c6c'
ID 239392
Institutional Source Beutler Lab
Gene Symbol Or6c6c
Ensembl Gene ENSMUSG00000095401
Gene Name olfactory receptor family 6 subfamily C member 6C
Synonyms GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R2211 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129540749-129541693 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129541320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 191 (H191R)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
AlphaFold Q7TRH7
Predicted Effect probably benign
Transcript: ENSMUST00000077312
AA Change: H191R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: H191R

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213331
AA Change: H191R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216747
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Or6c6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Or6c6c APN 10 129,541,492 (GRCm39) missense probably benign 0.01
IGL02041:Or6c6c APN 10 129,541,104 (GRCm39) missense probably damaging 1.00
IGL02245:Or6c6c APN 10 129,541,608 (GRCm39) missense probably damaging 1.00
IGL02341:Or6c6c APN 10 129,541,358 (GRCm39) missense probably damaging 0.99
IGL02433:Or6c6c APN 10 129,541,445 (GRCm39) missense probably benign 0.01
authen UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R0111:Or6c6c UTSW 10 129,541,146 (GRCm39) missense probably damaging 1.00
R0309:Or6c6c UTSW 10 129,541,008 (GRCm39) missense probably benign 0.38
R0326:Or6c6c UTSW 10 129,541,638 (GRCm39) missense possibly damaging 0.69
R0374:Or6c6c UTSW 10 129,541,516 (GRCm39) missense probably benign 0.00
R1573:Or6c6c UTSW 10 129,541,487 (GRCm39) missense probably damaging 1.00
R1663:Or6c6c UTSW 10 129,541,160 (GRCm39) missense probably benign 0.44
R1778:Or6c6c UTSW 10 129,541,574 (GRCm39) missense probably benign 0.01
R1789:Or6c6c UTSW 10 129,541,476 (GRCm39) missense possibly damaging 0.82
R1906:Or6c6c UTSW 10 129,541,365 (GRCm39) missense probably benign 0.00
R2108:Or6c6c UTSW 10 129,541,490 (GRCm39) missense probably benign
R2432:Or6c6c UTSW 10 129,540,794 (GRCm39) missense possibly damaging 0.91
R2902:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R4114:Or6c6c UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R5149:Or6c6c UTSW 10 129,541,377 (GRCm39) missense probably benign 0.00
R5153:Or6c6c UTSW 10 129,541,026 (GRCm39) missense probably benign 0.05
R5846:Or6c6c UTSW 10 129,540,756 (GRCm39) missense probably damaging 0.99
R6553:Or6c6c UTSW 10 129,540,932 (GRCm39) missense probably benign 0.07
R7676:Or6c6c UTSW 10 129,541,155 (GRCm39) missense possibly damaging 0.63
R8161:Or6c6c UTSW 10 129,540,753 (GRCm39) missense possibly damaging 0.94
R9266:Or6c6c UTSW 10 129,541,547 (GRCm39) missense probably benign 0.17
R9318:Or6c6c UTSW 10 129,541,283 (GRCm39) missense probably benign 0.00
R9334:Or6c6c UTSW 10 129,541,683 (GRCm39) missense probably benign 0.00
R9746:Or6c6c UTSW 10 129,541,208 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTATCATCATGAACAGCAAAGTGTG -3'
(R):5'- ACTCTCTCCCTTGCAGATGG -3'

Sequencing Primer
(F):5'- AGTGTGCCACCAACTCGTC -3'
(R):5'- CTCCCTTGCAGATGGTTTAATATAC -3'
Posted On 2014-10-15