Incidental Mutation 'R2211:Hic1'
ID 239395
Institutional Source Beutler Lab
Gene Symbol Hic1
Ensembl Gene ENSMUSG00000043099
Gene Name hypermethylated in cancer 1
Synonyms HIC-1
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.368) question?
Stock # R2211 (G1)
Quality Score 209
Status Not validated
Chromosome 11
Chromosomal Location 75055391-75060345 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75060210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 46 (R46W)
Ref Sequence ENSEMBL: ENSMUSP00000053483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045281
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000055619
AA Change: R46W

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099
AA Change: R46W

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
BTB 207 313 6.94e-24 SMART
low complexity region 318 340 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
Blast:BTB 375 398 1e-7 BLAST
low complexity region 415 437 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
ZnF_C2H2 597 619 1.08e-1 SMART
ZnF_C2H2 667 689 1.18e-2 SMART
ZnF_C2H2 695 717 9.36e-6 SMART
ZnF_C2H2 723 745 4.54e-4 SMART
ZnF_C2H2 751 773 5.21e-4 SMART
low complexity region 774 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083656
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134252
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit varying abnormalities, such as acrania, exencephaly, cleft palate, limb defects, and omphalocele, and die perinatally. Heterozygotes develop tumors, including lymphomas, sarcomas, and epithelial cancers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Hic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Hic1 APN 11 75,056,345 (GRCm39) missense possibly damaging 0.96
cough UTSW 11 75,057,143 (GRCm39) missense possibly damaging 0.93
Cup UTSW 11 75,058,200 (GRCm39) missense probably damaging 0.97
Undulate UTSW 11 75,057,042 (GRCm39) missense possibly damaging 0.96
R0138:Hic1 UTSW 11 75,058,169 (GRCm39) missense probably damaging 0.99
R0331:Hic1 UTSW 11 75,056,316 (GRCm39) missense possibly damaging 0.53
R0491:Hic1 UTSW 11 75,057,136 (GRCm39) missense possibly damaging 0.86
R0521:Hic1 UTSW 11 75,057,713 (GRCm39) missense possibly damaging 0.68
R0744:Hic1 UTSW 11 75,056,627 (GRCm39) missense possibly damaging 0.52
R1766:Hic1 UTSW 11 75,056,620 (GRCm39) nonsense probably null
R2070:Hic1 UTSW 11 75,059,885 (GRCm39) missense possibly damaging 0.68
R5418:Hic1 UTSW 11 75,057,425 (GRCm39) splice site probably null
R6047:Hic1 UTSW 11 75,057,675 (GRCm39) missense possibly damaging 0.94
R6076:Hic1 UTSW 11 75,058,154 (GRCm39) missense probably damaging 1.00
R6415:Hic1 UTSW 11 75,057,143 (GRCm39) missense possibly damaging 0.93
R6633:Hic1 UTSW 11 75,060,324 (GRCm39) missense unknown
R7122:Hic1 UTSW 11 75,060,056 (GRCm39) missense probably benign
R7308:Hic1 UTSW 11 75,057,977 (GRCm39) missense probably damaging 1.00
R7761:Hic1 UTSW 11 75,058,200 (GRCm39) missense probably damaging 0.97
R7778:Hic1 UTSW 11 75,057,042 (GRCm39) missense possibly damaging 0.96
R7824:Hic1 UTSW 11 75,057,042 (GRCm39) missense possibly damaging 0.96
R8230:Hic1 UTSW 11 75,056,411 (GRCm39) missense possibly damaging 0.85
R8419:Hic1 UTSW 11 75,057,096 (GRCm39) missense possibly damaging 0.96
R8752:Hic1 UTSW 11 75,060,206 (GRCm39) missense probably benign 0.00
R8832:Hic1 UTSW 11 75,057,728 (GRCm39) missense possibly damaging 0.86
R8857:Hic1 UTSW 11 75,056,228 (GRCm39) missense probably benign 0.33
R9068:Hic1 UTSW 11 75,060,332 (GRCm39) missense unknown
R9157:Hic1 UTSW 11 75,057,053 (GRCm39) missense possibly damaging 0.96
R9497:Hic1 UTSW 11 75,060,131 (GRCm39) missense possibly damaging 0.92
R9594:Hic1 UTSW 11 75,056,757 (GRCm39) missense possibly damaging 0.71
RF029:Hic1 UTSW 11 75,060,268 (GRCm39) small deletion probably benign
RF043:Hic1 UTSW 11 75,060,281 (GRCm39) small deletion probably benign
Z1186:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1187:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1188:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1189:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1190:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1191:Hic1 UTSW 11 75,060,275 (GRCm39) frame shift probably null
Z1191:Hic1 UTSW 11 75,060,274 (GRCm39) frame shift probably null
Z1191:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1191:Hic1 UTSW 11 75,060,276 (GRCm39) small deletion probably benign
Z1192:Hic1 UTSW 11 75,060,276 (GRCm39) small deletion probably benign
Z1192:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTCTTATCTGGAGCGGC -3'
(R):5'- TCGTAGTGTTCCACCCCAAC -3'

Sequencing Primer
(F):5'- TTATCTGGAGCGGCCCGAAC -3'
(R):5'- CATCCCTGGCTTAAGAGT -3'
Posted On 2014-10-15