Incidental Mutation 'R2211:Mpp5'
ID239400
Institutional Source Beutler Lab
Gene Symbol Mpp5
Ensembl Gene ENSMUSG00000021112
Gene Namemembrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)
SynonymsPals1, 3830420B02Rik
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location78748907-78840714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78797248 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 75 (K75N)
Ref Sequence ENSEMBL: ENSMUSP00000151349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082024] [ENSMUST00000219197] [ENSMUST00000219667]
Predicted Effect probably benign
Transcript: ENSMUST00000082024
AA Change: K75N

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080683
Gene: ENSMUSG00000021112
AA Change: K75N

DomainStartEndE-ValueType
coiled coil region 54 76 N/A INTRINSIC
L27 123 180 2.04e-10 SMART
L27 186 238 7.39e-8 SMART
PDZ 265 336 5.99e-13 SMART
SH3 348 416 1.2e-10 SMART
low complexity region 439 454 N/A INTRINSIC
GuKc 478 663 1.72e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000219197
AA Change: K75N

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219667
AA Change: K41N

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p55-like subfamily of the membrane-associated guanylate kinase (MAGUK) gene superfamily. The encoded protein participates in the polarization of differentiating cells, has been shown to regulate myelinating Schwann cells (PMID: 20237282), and is one of the components of the Crumbs complex in the retina. Mice which express lower levels of the orthologous protein have retinal degeneration and impaired vision (PMID: 22114289). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a floxed allele activated in cortical neuron exhibit loss of cortex neurons due to premature differentiation and increased apoptosis. These mice also exhibit behavioral defects but are otherwise viable and fertile. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Mpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mpp5 APN 12 78829799 missense possibly damaging 0.89
IGL00863:Mpp5 APN 12 78809821 missense probably damaging 1.00
IGL01860:Mpp5 APN 12 78830907 missense possibly damaging 0.79
R1584:Mpp5 UTSW 12 78829727 missense probably benign 0.34
R1632:Mpp5 UTSW 12 78797038 nonsense probably null
R2117:Mpp5 UTSW 12 78809922 missense possibly damaging 0.81
R2186:Mpp5 UTSW 12 78819371 splice site probably benign
R4044:Mpp5 UTSW 12 78824839 missense probably benign 0.06
R4224:Mpp5 UTSW 12 78829718 missense probably damaging 1.00
R4535:Mpp5 UTSW 12 78824837 missense possibly damaging 0.90
R5157:Mpp5 UTSW 12 78820815 missense possibly damaging 0.95
R6144:Mpp5 UTSW 12 78824789 missense possibly damaging 0.75
R6180:Mpp5 UTSW 12 78817310 missense probably benign 0.11
R7037:Mpp5 UTSW 12 78797199 missense probably damaging 1.00
R7216:Mpp5 UTSW 12 78797232 missense probably damaging 0.99
R8084:Mpp5 UTSW 12 78820851 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCATGACAACATCATATATGAATGGGC -3'
(R):5'- TCGTTAGGGTATGCAAGGAACC -3'

Sequencing Primer
(F):5'- TCATATATGAATGGGCATGTAACAG -3'
(R):5'- GGAACCAAAGCAAAACATATTGTGC -3'
Posted On2014-10-15