Incidental Mutation 'R2211:Il3ra'
ID 239407
Institutional Source Beutler Lab
Gene Symbol Il3ra
Ensembl Gene ENSMUSG00000068758
Gene Name interleukin 3 receptor, alpha chain
Synonyms CD123, SUT-1, IL-3 receptor alpha chain
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R2211 (G1)
Quality Score 191
Status Not validated
Chromosome 14
Chromosomal Location 8114270-8123851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14355029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 271 (C271R)
Ref Sequence ENSEMBL: ENSMUSP00000153086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090591] [ENSMUST00000223589] [ENSMUST00000224163] [ENSMUST00000224877] [ENSMUST00000225775]
AlphaFold P26952
Predicted Effect probably benign
Transcript: ENSMUST00000090591
AA Change: C364R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088079
Gene: ENSMUSG00000068758
AA Change: C364R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL6Ra-bind 119 233 6.1e-33 PFAM
transmembrane domain 333 355 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000223589
AA Change: C164R
Predicted Effect probably benign
Transcript: ENSMUST00000224163
AA Change: C364R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224415
Predicted Effect probably benign
Transcript: ENSMUST00000224877
AA Change: C271R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225560
Predicted Effect probably benign
Transcript: ENSMUST00000225775
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
PHENOTYPE: A number of distantly related inbred mouse strains carrying an identical spontaneous deletion at the branch point in intron 7 exhibit a reduced capacity of bone marrow cells to form colonies in response to interleukin-3 in CFU-GM assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Il3ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02454:Il3ra APN 14 14,351,113 (GRCm38) missense probably benign 0.36
IGL02547:Il3ra APN 14 14,351,970 (GRCm38) missense probably benign 0.01
IGL02550:Il3ra APN 14 14,348,055 (GRCm38) missense probably benign 0.03
IGL02632:Il3ra APN 14 14,350,807 (GRCm38) critical splice donor site probably null
IGL02737:Il3ra APN 14 14,350,760 (GRCm38) missense probably benign 0.02
R0165:Il3ra UTSW 14 14,350,967 (GRCm38) missense probably benign 0.01
R0597:Il3ra UTSW 14 14,351,166 (GRCm38) critical splice donor site probably null
R1109:Il3ra UTSW 14 14,349,317 (GRCm38) missense probably damaging 1.00
R2409:Il3ra UTSW 14 14,349,377 (GRCm38) splice site probably null
R4258:Il3ra UTSW 14 14,347,961 (GRCm38) missense probably damaging 1.00
R4896:Il3ra UTSW 14 14,355,381 (GRCm38) missense probably benign 0.07
R4994:Il3ra UTSW 14 14,351,080 (GRCm38) missense probably benign 0.19
R5004:Il3ra UTSW 14 14,355,381 (GRCm38) missense probably benign 0.07
R5935:Il3ra UTSW 14 14,350,799 (GRCm38) missense probably damaging 0.99
R6274:Il3ra UTSW 14 14,350,180 (GRCm38) missense probably benign 0.19
R6350:Il3ra UTSW 14 14,348,903 (GRCm38) missense probably benign 0.07
R6403:Il3ra UTSW 14 14,347,137 (GRCm38) missense probably damaging 0.98
R6845:Il3ra UTSW 14 14,346,517 (GRCm38) splice site probably null
R7417:Il3ra UTSW 14 14,349,345 (GRCm38) missense probably benign 0.08
R7432:Il3ra UTSW 14 14,350,691 (GRCm38) missense possibly damaging 0.64
R7450:Il3ra UTSW 14 14,351,090 (GRCm38) missense probably benign 0.25
R7917:Il3ra UTSW 14 14,350,773 (GRCm38) missense possibly damaging 0.66
R8048:Il3ra UTSW 14 14,348,903 (GRCm38) missense probably benign 0.07
Z1088:Il3ra UTSW 14 14,351,129 (GRCm38) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCAAATTGCTGCCCCAAAC -3'
(R):5'- GTCCCACCAGAGTTACTTCATG -3'

Sequencing Primer
(F):5'- CCAAACCTATGGTGGGATGC -3'
(R):5'- CACCAGAGTTACTTCATGTATCAATG -3'
Posted On 2014-10-15