Incidental Mutation 'R2211:Il3ra'
ID239407
Institutional Source Beutler Lab
Gene Symbol Il3ra
Ensembl Gene ENSMUSG00000068758
Gene Nameinterleukin 3 receptor, alpha chain
SynonymsIL-3 receptor alpha chain, CD123, SUT-1
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2211 (G1)
Quality Score191
Status Not validated
Chromosome14
Chromosomal Location14346275-14356011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14355029 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 271 (C271R)
Ref Sequence ENSEMBL: ENSMUSP00000153086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090591] [ENSMUST00000223589] [ENSMUST00000224163] [ENSMUST00000224877] [ENSMUST00000225775]
Predicted Effect probably benign
Transcript: ENSMUST00000090591
AA Change: C364R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088079
Gene: ENSMUSG00000068758
AA Change: C364R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL6Ra-bind 119 233 6.1e-33 PFAM
transmembrane domain 333 355 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000223589
AA Change: C164R
Predicted Effect probably benign
Transcript: ENSMUST00000224163
AA Change: C364R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224415
Predicted Effect probably benign
Transcript: ENSMUST00000224877
AA Change: C271R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225560
Predicted Effect probably benign
Transcript: ENSMUST00000225775
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
PHENOTYPE: A number of distantly related inbred mouse strains carrying an identical spontaneous deletion at the branch point in intron 7 exhibit a reduced capacity of bone marrow cells to form colonies in response to interleukin-3 in CFU-GM assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Il3ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02454:Il3ra APN 14 14351113 missense probably benign 0.36
IGL02547:Il3ra APN 14 14351970 missense probably benign 0.01
IGL02550:Il3ra APN 14 14348055 missense probably benign 0.03
IGL02632:Il3ra APN 14 14350807 critical splice donor site probably null
IGL02737:Il3ra APN 14 14350760 missense probably benign 0.02
R0165:Il3ra UTSW 14 14350967 missense probably benign 0.01
R0597:Il3ra UTSW 14 14351166 critical splice donor site probably null
R1109:Il3ra UTSW 14 14349317 missense probably damaging 1.00
R2409:Il3ra UTSW 14 14349377 splice site probably null
R4258:Il3ra UTSW 14 14347961 missense probably damaging 1.00
R4896:Il3ra UTSW 14 14355381 missense probably benign 0.07
R4994:Il3ra UTSW 14 14351080 missense probably benign 0.19
R5004:Il3ra UTSW 14 14355381 missense probably benign 0.07
R5935:Il3ra UTSW 14 14350799 missense probably damaging 0.99
R6274:Il3ra UTSW 14 14350180 missense probably benign 0.19
R6350:Il3ra UTSW 14 14348903 missense probably benign 0.07
R6403:Il3ra UTSW 14 14347137 missense probably damaging 0.98
R6845:Il3ra UTSW 14 14346517 splice site probably null
R7417:Il3ra UTSW 14 14349345 missense probably benign 0.08
R7432:Il3ra UTSW 14 14350691 missense possibly damaging 0.64
R7450:Il3ra UTSW 14 14351090 missense probably benign 0.25
R7917:Il3ra UTSW 14 14350773 missense possibly damaging 0.66
R8048:Il3ra UTSW 14 14348903 missense probably benign 0.07
Z1088:Il3ra UTSW 14 14351129 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCAAATTGCTGCCCCAAAC -3'
(R):5'- GTCCCACCAGAGTTACTTCATG -3'

Sequencing Primer
(F):5'- CCAAACCTATGGTGGGATGC -3'
(R):5'- CACCAGAGTTACTTCATGTATCAATG -3'
Posted On2014-10-15