Incidental Mutation 'R2211:Rarg'
ID239409
Institutional Source Beutler Lab
Gene Symbol Rarg
Ensembl Gene ENSMUSG00000001288
Gene Nameretinoic acid receptor, gamma
SynonymsRAR gamma 2, RARgamma2
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102234938-102257517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102239524 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 284 (N284S)
Ref Sequence ENSEMBL: ENSMUSP00000067266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043172] [ENSMUST00000063339] [ENSMUST00000130204] [ENSMUST00000135466] [ENSMUST00000155563]
Predicted Effect probably benign
Transcript: ENSMUST00000043172
AA Change: N295S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048838
Gene: ENSMUSG00000001288
AA Change: N295S

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
HOLI 232 390 9.07e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063339
AA Change: N284S

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067266
Gene: ENSMUSG00000001288
AA Change: N284S

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
ZnF_C4 76 147 1.53e-40 SMART
HOLI 221 379 9.07e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124224
Predicted Effect probably benign
Transcript: ENSMUST00000130204
Predicted Effect probably benign
Transcript: ENSMUST00000135466
SMART Domains Protein: ENSMUSP00000118615
Gene: ENSMUSG00000001288

DomainStartEndE-ValueType
low complexity region 10 32 N/A INTRINSIC
low complexity region 75 84 N/A INTRINSIC
ZnF_C4 87 158 1.53e-40 SMART
PDB:1EXX|A 178 227 5e-28 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155563
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted growth, homeotic transformations of the rostral axial skeleton and tracheal cartilage, Harderian gland agenesis, high postnatal mortality, and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Rarg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02877:Rarg APN 15 102241939 splice site probably null
R0033:Rarg UTSW 15 102238835 missense probably damaging 0.99
R0539:Rarg UTSW 15 102238877 missense probably damaging 1.00
R1137:Rarg UTSW 15 102241160 missense probably damaging 1.00
R1593:Rarg UTSW 15 102239941 missense probably damaging 1.00
R1916:Rarg UTSW 15 102252445 missense probably benign 0.00
R1926:Rarg UTSW 15 102239545 missense probably damaging 1.00
R2057:Rarg UTSW 15 102239504 missense probably damaging 0.99
R4581:Rarg UTSW 15 102252551 missense possibly damaging 0.70
R5718:Rarg UTSW 15 102241067 missense probably damaging 1.00
R6197:Rarg UTSW 15 102241892 missense possibly damaging 0.94
R6991:Rarg UTSW 15 102241915 missense probably damaging 1.00
R7300:Rarg UTSW 15 102252417 critical splice donor site probably null
R8104:Rarg UTSW 15 102239899 missense probably damaging 1.00
R8121:Rarg UTSW 15 102239958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCAGGGCTTCTGCGTTC -3'
(R):5'- AGCAGTTCCCTCCTGGTTTG -3'

Sequencing Primer
(F):5'- CTGAGAAGTCTGTAGGAACAATTC -3'
(R):5'- TTTCCAATCTCAAGAGTCCCAC -3'
Posted On2014-10-15