Incidental Mutation 'R0183:Gcnt1'
ID23941
Institutional Source Beutler Lab
Gene Symbol Gcnt1
Ensembl Gene ENSMUSG00000038843
Gene Nameglucosaminyl (N-acetyl) transferase 1, core 2
SynonymsC2 GlcNAcT, 5630400D21Rik, IGnT, beta-1, 6-N-acetylglucosaminyltransferase
MMRRC Submission 038448-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0183 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location17326141-17356667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17329117 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 415 (D415N)
Ref Sequence ENSEMBL: ENSMUSP00000133935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169897] [ENSMUST00000174236]
PDB Structure
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) [X-RAY DIFFRACTION]
X-ray crystal structure of murine leukocyte-type Core 2 b1,6-N-acetylglucosaminyltransferase (C2GnT-L) in complex with Galb1,3GalNAc [X-RAY DIFFRACTION]
Structure and mechanisim of core 2 beta1,6-n-acetylglucosaminyltransferase: a Metal-ion independent gt-a glycosyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000169897
AA Change: D415N

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127835
Gene: ENSMUSG00000038843
AA Change: D415N

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
Pfam:Branch 123 392 9.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174137
Predicted Effect probably benign
Transcript: ENSMUST00000174236
AA Change: D415N

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133935
Gene: ENSMUSG00000038843
AA Change: D415N

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Branch 127 396 5.7e-65 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 84% (42/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,6-N-acetylglucosaminyltransferase gene family. It is essential to the formation of Gal beta 1-3(GlcNAc beta 1-6)GalNAc structures and the core 2 O-glycan branch. The gene coding this enzyme was originally mapped to 9q21, but was later localized to 9q13. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele display a grossly normal phenotype and are fertile. There are abnormalities in white blood cell counts and in inflammatory response however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,235 D490N probably benign Het
Aatf A T 11: 84,510,425 probably null Het
Amer3 T A 1: 34,587,757 I359K probably damaging Het
Appl1 A T 14: 26,962,854 D79E probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Baz1a T A 12: 54,911,387 E1026D probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Card14 C T 11: 119,326,698 R386C probably damaging Het
Cenpb T C 2: 131,178,453 probably benign Het
Clcn4 G A 7: 7,295,091 Q40* probably null Het
Clec16a T C 16: 10,560,022 Y28H probably damaging Het
Cul4a T C 8: 13,133,790 S393P probably damaging Het
Dcbld2 A G 16: 58,445,359 D194G possibly damaging Het
Dnah6 C T 6: 73,082,923 V2841I probably damaging Het
Eaf1 T A 14: 31,495,315 L16Q probably damaging Het
Eef1e1 C T 13: 38,656,186 A48T probably damaging Het
Exoc3l C A 8: 105,295,300 R57L probably damaging Het
Faf1 A G 4: 109,935,610 N593S probably benign Het
Fosb A G 7: 19,307,385 I61T probably damaging Het
Fstl5 A C 3: 76,322,272 I127L possibly damaging Het
Gas2l2 T A 11: 83,429,056 M125L probably benign Het
Gtpbp4 A G 13: 8,974,961 M531T probably benign Het
Gucy1b2 T A 14: 62,419,140 K256M probably damaging Het
Igf2bp2 A T 16: 22,078,730 Y244* probably null Het
Jkamp T C 12: 72,094,035 I118T possibly damaging Het
Kalrn A T 16: 34,171,379 probably null Het
Kcnma1 A T 14: 23,508,052 D317E probably damaging Het
Lipo2 A T 19: 33,749,551 probably null Het
Lrig3 T A 10: 126,010,192 I830K probably damaging Het
Map3k4 A G 17: 12,235,128 I1429T probably damaging Het
Mkks G A 2: 136,880,686 L184F probably benign Het
Mmp19 C T 10: 128,799,003 T424I possibly damaging Het
Mrps23 A G 11: 88,210,154 E57G probably damaging Het
Myh7 T C 14: 54,978,876 T1282A probably benign Het
Olfr1046 T A 2: 86,216,829 S294C probably damaging Het
Olfr1380 A G 11: 49,564,848 D309G probably benign Het
Phf19 T C 2: 34,911,202 N75S probably damaging Het
Pink1 T G 4: 138,314,179 H477P probably damaging Het
Ppp6r2 G A 15: 89,285,787 C835Y probably damaging Het
Prkcq T C 2: 11,253,162 I295T probably damaging Het
Ptpn13 T C 5: 103,516,408 S421P probably benign Het
Ptpn6 A G 6: 124,728,951 S77P probably damaging Het
Ptpre G T 7: 135,669,845 M389I probably benign Het
Ranbp9 T C 13: 43,425,123 D158G probably damaging Het
Sec14l3 C T 11: 4,075,547 S357L probably benign Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Spef2 A T 15: 9,716,359 D323E possibly damaging Het
Taf2 T A 15: 55,055,790 K396N possibly damaging Het
Tcf12 A T 9: 71,917,027 V94E probably damaging Het
Trim24 T A 6: 37,943,480 I404N possibly damaging Het
Other mutations in Gcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02700:Gcnt1 APN 19 17329416 missense probably damaging 1.00
IGL02836:Gcnt1 APN 19 17330129 missense probably benign
IGL02977:Gcnt1 APN 19 17329374 missense probably damaging 1.00
IGL03302:Gcnt1 APN 19 17329183 missense probably benign 0.25
magenta UTSW 19 17329404 missense probably damaging 1.00
Violet UTSW 19 17329359 missense probably damaging 1.00
R0440:Gcnt1 UTSW 19 17330316 missense probably benign 0.00
R1159:Gcnt1 UTSW 19 17329804 missense possibly damaging 0.90
R1523:Gcnt1 UTSW 19 17329833 missense probably damaging 1.00
R2240:Gcnt1 UTSW 19 17329331 missense possibly damaging 0.91
R4510:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R4511:Gcnt1 UTSW 19 17330277 missense probably benign 0.00
R5689:Gcnt1 UTSW 19 17329404 missense probably damaging 1.00
R7765:Gcnt1 UTSW 19 17329359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATTCATGCAGTTTCCCTGACAG -3'
(R):5'- TGGTTCTTTCCCCTCAAGCAACAAG -3'

Sequencing Primer
(F):5'- CAGTTTCCCTGACAGGAAGAC -3'
(R):5'- GACTTGTCAGACATGAATGCC -3'
Posted On2013-04-16