Incidental Mutation 'R2211:Lmln'
ID 239410
Institutional Source Beutler Lab
Gene Symbol Lmln
Ensembl Gene ENSMUSG00000022802
Gene Name leishmanolysin-like (metallopeptidase M8 family)
Synonyms 5330415H22Rik
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R2211 (G1)
Quality Score 208
Status Not validated
Chromosome 16
Chromosomal Location 32882891-32948065 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32930148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 535 (E535G)
Ref Sequence ENSEMBL: ENSMUSP00000023497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023497]
AlphaFold Q8BMN4
Predicted Effect probably benign
Transcript: ENSMUST00000023497
AA Change: E535G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000023497
Gene: ENSMUSG00000022802
AA Change: E535G

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Peptidase_M8 154 289 3.9e-16 PFAM
Pfam:Peptidase_M8 295 633 5.2e-54 PFAM
transmembrane domain 658 680 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158235
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-metallopeptidase. The encoded protein may play a role in cell migration and invasion. Studies of a similar protein in Drosophila indicate a potential role in mitotic progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Lmln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Lmln APN 16 32,903,435 (GRCm39) missense probably benign 0.08
IGL01346:Lmln APN 16 32,937,490 (GRCm39) missense probably benign 0.00
IGL01664:Lmln APN 16 32,901,357 (GRCm39) missense probably benign 0.03
nemeth UTSW 16 32,894,467 (GRCm39) nonsense probably null
R0234:Lmln UTSW 16 32,886,694 (GRCm39) missense probably damaging 0.99
R0234:Lmln UTSW 16 32,886,694 (GRCm39) missense probably damaging 0.99
R0562:Lmln UTSW 16 32,937,455 (GRCm39) nonsense probably null
R1017:Lmln UTSW 16 32,908,546 (GRCm39) missense probably benign
R1557:Lmln UTSW 16 32,908,581 (GRCm39) missense probably benign 0.25
R1617:Lmln UTSW 16 32,937,500 (GRCm39) missense probably damaging 1.00
R4061:Lmln UTSW 16 32,886,761 (GRCm39) nonsense probably null
R4414:Lmln UTSW 16 32,930,220 (GRCm39) missense probably benign 0.00
R4512:Lmln UTSW 16 32,908,507 (GRCm39) missense probably benign 0.01
R4564:Lmln UTSW 16 32,930,226 (GRCm39) missense probably benign 0.09
R4995:Lmln UTSW 16 32,894,467 (GRCm39) nonsense probably null
R5044:Lmln UTSW 16 32,894,550 (GRCm39) missense possibly damaging 0.80
R6109:Lmln UTSW 16 32,889,481 (GRCm39) missense possibly damaging 0.69
R6287:Lmln UTSW 16 32,894,555 (GRCm39) critical splice donor site probably null
R6577:Lmln UTSW 16 32,927,370 (GRCm39) splice site probably null
R6689:Lmln UTSW 16 32,925,152 (GRCm39) missense probably benign 0.19
R7079:Lmln UTSW 16 32,887,661 (GRCm39) missense probably benign 0.02
R7432:Lmln UTSW 16 32,909,738 (GRCm39) missense probably damaging 1.00
R7807:Lmln UTSW 16 32,927,501 (GRCm39) missense probably benign 0.04
R8185:Lmln UTSW 16 32,909,690 (GRCm39) missense probably damaging 1.00
R8942:Lmln UTSW 16 32,901,330 (GRCm39) missense probably damaging 0.99
R9123:Lmln UTSW 16 32,930,202 (GRCm39) missense probably benign 0.01
R9365:Lmln UTSW 16 32,925,169 (GRCm39) nonsense probably null
R9491:Lmln UTSW 16 32,890,358 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCCAGTTGAGTTTGGAGTC -3'
(R):5'- AAACCTCCTTGCGTGGATG -3'

Sequencing Primer
(F):5'- CTGAGACTGTGCTTCAAACTCAG -3'
(R):5'- CGTGGATGGTGGCTGAGTCC -3'
Posted On 2014-10-15