Mutagenetix > Incidental Mutation

Incidental Mutation 'R2211:Notch3'

239414

Institutional Source

Beutler Lab

Gene Symbol

Notch3

Ensembl Gene

ENSMUSG00000038146

Gene Name

notch 3

Synonyms

N3, hpbk

MMRRC Submission

040213-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2211 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32120820-32166880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32147978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 861 (H861L)

Ref Sequence

ENSEMBL: ENSMUSP00000085016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087723]

AlphaFold

Q61982

Predicted Effect

probably benign
Transcript: ENSMUST00000087723
AA Change: H861L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: H861L

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
EGF	42	78	3.73e-5	SMART
EGF	82	119	1.78e-2	SMART
EGF	123	157	1.13e-4	SMART
EGF_CA	159	196	1.89e-15	SMART
EGF	201	235	3.85e-7	SMART
EGF_CA	237	273	3.97e-9	SMART
EGF_CA	275	313	4.63e-10	SMART
EGF_CA	315	351	1.05e-8	SMART
EGF	355	390	1.28e-3	SMART
EGF_CA	392	430	6.29e-12	SMART
EGF_CA	432	468	1.11e-12	SMART
EGF_CA	470	506	4.21e-13	SMART
EGF_CA	508	544	8.43e-13	SMART
EGF_CA	546	581	9.54e-12	SMART
EGF_CA	583	619	1.31e-9	SMART
EGF_CA	621	656	2.03e-6	SMART
EGF_CA	658	694	2.28e-9	SMART
EGF	699	731	7.18e-7	SMART
EGF	738	771	2.5e-6	SMART
EGF	775	809	8e-5	SMART
EGF_CA	811	848	4.77e-12	SMART
EGF_CA	850	886	3.81e-11	SMART
EGF_CA	888	923	1.47e-12	SMART
EGF_CA	925	961	3.4e-8	SMART
EGF	966	999	5.74e-6	SMART
EGF	1004	1035	7.18e-7	SMART
EGF	1040	1083	1.21e-4	SMART
EGF_CA	1085	1121	1.29e-8	SMART
EGF_CA	1123	1159	1.45e-11	SMART
EGF_CA	1161	1204	1.26e-11	SMART
EGF	1209	1245	1.53e-1	SMART
EGF	1250	1288	8e-5	SMART
EGF	1293	1326	1.13e1	SMART
EGF	1339	1374	5.36e-6	SMART
NL	1381	1419	1.63e-15	SMART
NL	1422	1460	1.78e-16	SMART
NL	1461	1502	1.75e-15	SMART
NOD	1506	1562	2.98e-24	SMART
NODP	1577	1641	1.34e-26	SMART
transmembrane domain	1644	1666	N/A	INTRINSIC
low complexity region	1774	1783	N/A	INTRINSIC
ANK	1789	1834	1.48e3	SMART
ANK	1839	1868	1.61e-4	SMART
ANK	1872	1902	1.42e0	SMART
ANK	1906	1935	1.77e-1	SMART
ANK	1939	1968	3.18e-3	SMART
ANK	1972	2001	5.16e-3	SMART
low complexity region	2028	2054	N/A	INTRINSIC
low complexity region	2108	2123	N/A	INTRINSIC
low complexity region	2169	2193	N/A	INTRINSIC
DUF3454	2218	2275	2.81e-20	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430078G23Rik	T	C	8: 3,387,680	S268P	possibly damaging	Het
Adam18	A	G	8: 24,628,155	S34P	probably damaging	Het
Adam23	T	A	1: 63,573,129		probably benign	Het
Adcy10	A	T	1: 165,518,212	I277F	probably damaging	Het
Arfgef3	A	T	10: 18,592,245	S1736T	possibly damaging	Het
Arhgap21	A	T	2: 20,881,640	M242K	possibly damaging	Het
Astn1	A	G	1: 158,657,306	R4G	probably benign	Het
AU041133	G	A	10: 82,150,921	C135Y	probably damaging	Het
Cdc42bpb	A	G	12: 111,301,854	V53A	probably benign	Het
Cdh23	T	C	10: 60,466,004	D428G	possibly damaging	Het
Cebpa	T	C	7: 35,120,466	S350P	probably damaging	Het
Cftr	A	G	6: 18,214,280	M152V	probably null	Het
Cpa4	A	G	6: 30,583,650	N255S	possibly damaging	Het
Ddx51	T	A	5: 110,655,768	D343E	probably damaging	Het
Dnah7a	T	C	1: 53,479,773	I2942V	probably benign	Het
Dnajc1	G	T	2: 18,392,475	A9E	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Edem3	A	G	1: 151,804,702	D526G	possibly damaging	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Etaa1	G	A	11: 17,952,686	Q84*	probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam149a	G	A	8: 45,341,009	T674I	probably damaging	Het
Fam98a	A	G	17: 75,538,945		probably null	Het
Fat4	A	G	3: 38,891,527	N1523S	possibly damaging	Het
Fbxw10	A	G	11: 62,867,535	T529A	probably damaging	Het
Gzf1	C	T	2: 148,684,950	A447V	probably damaging	Het
Hap1	G	A	11: 100,354,724	T138M	probably benign	Het
Hic1	T	A	11: 75,169,384	R46W	possibly damaging	Het
Id4	T	A	13: 48,261,802	L102Q	probably damaging	Het
Il3ra	T	C	14: 14,355,029	C271R	probably benign	Het
Ints4	T	C	7: 97,509,750	I443T	possibly damaging	Het
Lmln	A	G	16: 33,109,778	E535G	probably benign	Het
Lrrtm4	A	G	6: 80,022,640	H345R	probably benign	Het
Ltbp3	T	C	19: 5,753,962	I834T	possibly damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Mpp5	A	T	12: 78,797,248	K75N	possibly damaging	Het
Ms4a18	C	A	19: 10,997,305	V341L	probably benign	Het
Nbr1	T	C	11: 101,567,264		probably null	Het
Nf1	T	C	11: 79,444,064	M914T	probably benign	Het
Nupl1	A	G	14: 60,232,640	F341L	probably damaging	Het
Ogfod2	C	A	5: 124,112,780		probably null	Het
Oit3	T	C	10: 59,428,070	D414G	probably damaging	Het
Olfr1079	T	C	2: 86,538,513	Y132C	probably damaging	Het
Olfr1497	T	A	19: 13,795,369	M81L	probably benign	Het
Olfr787	A	T	10: 129,462,940	K88M	probably damaging	Het
Olfr804	A	G	10: 129,705,451	H191R	probably benign	Het
Pcbp4	C	A	9: 106,460,734	H74Q	probably benign	Het
Pip5k1b	A	T	19: 24,378,850	D241E	probably damaging	Het
Plcb2	T	C	2: 118,723,534	D102G	probably benign	Het
Plekha5	G	A	6: 140,525,861	E4K	possibly damaging	Het
Ppargc1a	A	C	5: 51,474,259	S343A	possibly damaging	Het
Ppwd1	G	A	13: 104,207,142	S585L	probably benign	Het
Rarg	T	C	15: 102,239,524	N284S	probably benign	Het
Rnpepl1	C	T	1: 92,916,380	L278F	probably damaging	Het
Rp1	A	C	1: 4,348,139	S917A	probably damaging	Het
Rsf1	ATGGCG	ATGGCGAGGGTGGCG	7: 97,579,904		probably benign	Het
Rsph3b	T	C	17: 6,941,740	S189G	probably benign	Het
Sec31b	A	T	19: 44,523,150	L604Q	probably damaging	Het
Sema6b	T	A	17: 56,124,741	I641F	probably benign	Het
Slc35f5	A	T	1: 125,579,264	I309F	possibly damaging	Het
Smarca4	A	G	9: 21,686,029	E1360G	probably damaging	Het
Spata31d1c	T	C	13: 65,035,939	S432P	probably benign	Het
Spsb3	T	C	17: 24,890,937		probably null	Het
Sptbn4	T	C	7: 27,367,609	D1960G	probably damaging	Het
Srgap1	A	G	10: 121,853,740	V345A	possibly damaging	Het
Tiam2	C	A	17: 3,414,918	C307*	probably null	Het
Trim43b	T	A	9: 89,085,249	T444S	possibly damaging	Het
Trmt13	A	G	3: 116,594,754	I11T	probably benign	Het
Ylpm1	A	T	12: 85,044,378	R1073*	probably null	Het
Zfp524	T	C	7: 5,017,919	S149P	probably damaging	Het
Zfp777	T	C	6: 48,043,885	I312V	possibly damaging	Het

Other mutations in Notch3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Notch3	APN	17	32158114	nonsense	probably null
IGL01065:Notch3	APN	17	32146416	nonsense	probably null
IGL01296:Notch3	APN	17	32166757	missense	unknown
IGL01322:Notch3	APN	17	32144471	missense	probably damaging	1.00
IGL01343:Notch3	APN	17	32143436	missense	probably benign	0.10
IGL01358:Notch3	APN	17	32144747	missense	probably damaging	1.00
IGL01600:Notch3	APN	17	32144498	missense	probably damaging	1.00
IGL01622:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01623:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01971:Notch3	APN	17	32124347	missense	probably damaging	1.00
IGL02000:Notch3	APN	17	32122742	missense	probably damaging	0.99
IGL02072:Notch3	APN	17	32147074	nonsense	probably null
IGL02145:Notch3	APN	17	32154741	missense	probably benign	0.01
IGL02256:Notch3	APN	17	32132324	missense	probably damaging	1.00
IGL02366:Notch3	APN	17	32144205	missense	probably benign
IGL02476:Notch3	APN	17	32158638	missense	possibly damaging	0.67
IGL02502:Notch3	APN	17	32158278	nonsense	probably null
IGL02551:Notch3	APN	17	32154731	splice site	probably benign
divide	UTSW	17	32137813	splice site	probably null
impressed	UTSW	17	32166678	missense	probably benign
indented	UTSW	17	32147963	missense	probably benign	0.00
Lopressor	UTSW	17	32153884	missense	probably damaging	1.00
marginal	UTSW	17	32164224	missense	probably benign
PIT4486001:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R0115:Notch3	UTSW	17	32133462	missense	possibly damaging	0.82
R0201:Notch3	UTSW	17	32156148	splice site	probably benign
R0630:Notch3	UTSW	17	32147472	splice site	probably benign
R1167:Notch3	UTSW	17	32122745	missense	possibly damaging	0.95
R1432:Notch3	UTSW	17	32164224	missense	probably benign
R1567:Notch3	UTSW	17	32158580	missense	possibly damaging	0.77
R1623:Notch3	UTSW	17	32139191	missense	probably benign	0.00
R1663:Notch3	UTSW	17	32156119	missense	probably damaging	1.00
R1668:Notch3	UTSW	17	32158589	missense	probably damaging	0.99
R1789:Notch3	UTSW	17	32158725	missense	probably damaging	1.00
R1813:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1837:Notch3	UTSW	17	32124322	missense	probably damaging	1.00
R1896:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1937:Notch3	UTSW	17	32153852	missense	probably benign	0.03
R1954:Notch3	UTSW	17	32166678	missense	probably benign
R2014:Notch3	UTSW	17	32158000	missense	probably benign	0.00
R2058:Notch3	UTSW	17	32143644	missense	probably benign
R2068:Notch3	UTSW	17	32135508	missense	probably benign	0.00
R2097:Notch3	UTSW	17	32122754	missense	probably damaging	1.00
R2112:Notch3	UTSW	17	32144610	missense	probably benign	0.19
R2156:Notch3	UTSW	17	32147844	missense	probably damaging	1.00
R2324:Notch3	UTSW	17	32150134	splice site	probably benign
R2432:Notch3	UTSW	17	32153804	missense	probably damaging	1.00
R3117:Notch3	UTSW	17	32158115	missense	probably damaging	1.00
R3236:Notch3	UTSW	17	32158461	missense	probably damaging	0.96
R3409:Notch3	UTSW	17	32150702	missense	possibly damaging	0.67
R3434:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3435:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3438:Notch3	UTSW	17	32153590	missense	probably damaging	1.00
R3926:Notch3	UTSW	17	32153557	missense	possibly damaging	0.92
R4087:Notch3	UTSW	17	32158113	missense	possibly damaging	0.60
R4115:Notch3	UTSW	17	32158433	missense	probably damaging	1.00
R4214:Notch3	UTSW	17	32132207	missense	possibly damaging	0.96
R4234:Notch3	UTSW	17	32141341	missense	probably damaging	0.97
R4242:Notch3	UTSW	17	32143745	missense	possibly damaging	0.74
R4658:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R4878:Notch3	UTSW	17	32147085	missense	probably damaging	1.00
R4879:Notch3	UTSW	17	32147963	missense	probably benign	0.00
R4885:Notch3	UTSW	17	32141377	missense	probably damaging	0.98
R4924:Notch3	UTSW	17	32144731	missense	probably damaging	1.00
R5084:Notch3	UTSW	17	32157890	critical splice donor site	probably null
R5086:Notch3	UTSW	17	32143334	missense	probably benign	0.13
R5343:Notch3	UTSW	17	32143283	missense	probably benign	0.03
R5389:Notch3	UTSW	17	32139189	missense	probably benign
R5503:Notch3	UTSW	17	32147055	missense	probably benign	0.00
R5698:Notch3	UTSW	17	32157987	missense	probably damaging	1.00
R5824:Notch3	UTSW	17	32153861	missense	possibly damaging	0.92
R5969:Notch3	UTSW	17	32153884	missense	probably damaging	1.00
R6050:Notch3	UTSW	17	32143527	missense	probably benign
R6274:Notch3	UTSW	17	32147290	missense	probably benign
R6276:Notch3	UTSW	17	32154749	missense	probably benign	0.10
R6313:Notch3	UTSW	17	32151154	splice site	probably null
R6316:Notch3	UTSW	17	32137813	splice site	probably null
R6380:Notch3	UTSW	17	32144559	missense	probably damaging	1.00
R6401:Notch3	UTSW	17	32158623	missense	probably benign	0.01
R6502:Notch3	UTSW	17	32158217	missense	probably damaging	1.00
R6741:Notch3	UTSW	17	32143484	missense	probably benign	0.16
R7131:Notch3	UTSW	17	32144217	missense	probably benign
R7140:Notch3	UTSW	17	32156377	missense	possibly damaging	0.84
R7162:Notch3	UTSW	17	32146449	missense	probably damaging	0.98
R7171:Notch3	UTSW	17	32158962	missense	probably damaging	1.00
R7449:Notch3	UTSW	17	32157966	missense	probably damaging	1.00
R7450:Notch3	UTSW	17	32141391	missense	possibly damaging	0.69
R7554:Notch3	UTSW	17	32122371	missense	probably benign	0.03
R7575:Notch3	UTSW	17	32154819	missense	possibly damaging	0.81
R7632:Notch3	UTSW	17	32158506	missense	probably benign
R7633:Notch3	UTSW	17	32158622	missense	probably benign	0.17
R7860:Notch3	UTSW	17	32122773	missense	possibly damaging	0.67
R8052:Notch3	UTSW	17	32146571	missense	probably damaging	1.00
R8250:Notch3	UTSW	17	32132336	missense	probably damaging	1.00
R8296:Notch3	UTSW	17	32122739	missense	probably damaging	1.00
R8306:Notch3	UTSW	17	32158112	missense	probably damaging	0.99
R8458:Notch3	UTSW	17	32156050	missense	probably damaging	1.00
R8539:Notch3	UTSW	17	32156355	missense	possibly damaging	0.92
R8865:Notch3	UTSW	17	32122116	missense	probably benign	0.01
R8925:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R8927:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R9062:Notch3	UTSW	17	32122718	missense	possibly damaging	0.93
R9079:Notch3	UTSW	17	32164059	intron	probably benign
R9089:Notch3	UTSW	17	32151547	missense	probably benign	0.00
R9260:Notch3	UTSW	17	32143242	critical splice donor site	probably null
R9289:Notch3	UTSW	17	32158280	missense	probably damaging	1.00
R9294:Notch3	UTSW	17	32143691	missense	probably benign	0.03
R9661:Notch3	UTSW	17	32154818	missense	probably damaging	1.00
R9779:Notch3	UTSW	17	32153783	missense	probably damaging	1.00
T0975:Notch3	UTSW	17	32146417	missense	probably damaging	0.99
Z1088:Notch3	UTSW	17	32158652	missense	possibly damaging	0.94
Z1176:Notch3	UTSW	17	32141516	missense	probably benign	0.12
Z1176:Notch3	UTSW	17	32151370	missense	probably damaging	1.00
Z1177:Notch3	UTSW	17	32166694	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCATAACCAGGTGGACAGG -3'
(R):5'- AAGGGGACTAACTTTGATCTCTGAC -3'

Sequencing Primer
(F):5'- TAACCAGGTGGACAGGCACAG -3'
(R):5'- CTTGTAGTCTGGGATACACACACG -3'

Posted On

2014-10-15