Incidental Mutation 'R2211:Sema6b'
ID 239415
Institutional Source Beutler Lab
Gene Symbol Sema6b
Ensembl Gene ENSMUSG00000001227
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms Sema, Seman, semaZ, VIb
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R2211 (G1)
Quality Score 185
Status Not validated
Chromosome 17
Chromosomal Location 56123085-56140343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 56124741 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 641 (I641F)
Ref Sequence ENSEMBL: ENSMUSP00000130985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001256] [ENSMUST00000041357] [ENSMUST00000167545]
AlphaFold O54951
Predicted Effect probably benign
Transcript: ENSMUST00000001256
AA Change: I641F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000001256
Gene: ENSMUSG00000001227
AA Change: I641F

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041357
SMART Domains Protein: ENSMUSP00000038048
Gene: ENSMUSG00000037095

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRR 84 107 1.86e0 SMART
LRR_TYP 108 131 3.63e-3 SMART
LRR 133 155 5.89e1 SMART
LRR_TYP 156 179 1.45e-2 SMART
LRR_TYP 180 203 8.47e-4 SMART
LRR 205 227 2.08e1 SMART
LRR 229 251 1.91e1 SMART
LRR 252 275 5.34e-1 SMART
LRRCT 292 342 9.69e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167545
AA Change: I641F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130985
Gene: ENSMUSG00000001227
AA Change: I641F

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family, a group of proteins characterized by the presence of a conserved semaphorin (sema) domain. Whereas some semaphorins are transmembrane proteins, others are secreted. Semaphorins play a major role in axon guidance. The protein encoded by this gene may be involved in both peripheral and central nervous system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mossy fiber and mossy cell axon projections, thickened suprapyramidal bundles, and elongated infrapyramydal bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sec31b A T 19: 44,523,150 L604Q probably damaging Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Sema6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Sema6b APN 17 56130048 missense probably damaging 1.00
IGL01102:Sema6b APN 17 56132761 missense possibly damaging 0.91
IGL01533:Sema6b APN 17 56129499 splice site probably benign
IGL01611:Sema6b APN 17 56129969 splice site probably null
IGL01996:Sema6b APN 17 56131157 missense probably damaging 1.00
IGL02118:Sema6b APN 17 56132821 missense probably benign
R0010:Sema6b UTSW 17 56124105 missense probably benign 0.06
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0525:Sema6b UTSW 17 56126630 missense probably damaging 0.96
R0635:Sema6b UTSW 17 56129971 critical splice donor site probably null
R1129:Sema6b UTSW 17 56124347 missense probably benign
R1927:Sema6b UTSW 17 56132797 missense probably benign 0.00
R4081:Sema6b UTSW 17 56128307 missense probably damaging 0.99
R5013:Sema6b UTSW 17 56132497 critical splice donor site probably null
R5296:Sema6b UTSW 17 56127091 critical splice acceptor site probably null
R5314:Sema6b UTSW 17 56128413 nonsense probably null
R6317:Sema6b UTSW 17 56124047 missense probably benign 0.26
R6419:Sema6b UTSW 17 56132784 nonsense probably null
R7255:Sema6b UTSW 17 56125336 missense probably benign 0.01
R7289:Sema6b UTSW 17 56125573 missense possibly damaging 0.77
R7805:Sema6b UTSW 17 56131555 missense probably damaging 1.00
R8157:Sema6b UTSW 17 56128448 missense probably damaging 1.00
R8290:Sema6b UTSW 17 56124803 missense possibly damaging 0.93
R8305:Sema6b UTSW 17 56127084 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAGGTCGTGAGGGC -3'
(R):5'- AAATCGCACTGCCACTTTCTC -3'

Sequencing Primer
(F):5'- TGAGGGCCACCATGCAG -3'
(R):5'- TCCCCAGGACTCTTGCG -3'
Posted On 2014-10-15