Incidental Mutation 'R0184:Antxr2'
List |< first << previous [record 4 of 75] next >> last >|
ID23942
Institutional Source Beutler Lab
Gene Symbol Antxr2
Ensembl Gene ENSMUSG00000029338
Gene Nameanthrax toxin receptor 2
Synonyms2310046B19Rik, CMG2, CMG-2, cI-35
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0184 (G1)
Quality Score210
Status Validated (trace)
Chromosome5
Chromosomal Location97882783-98031043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97980030 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 214 (L214S)
Ref Sequence ENSEMBL: ENSMUSP00000142605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031281] [ENSMUST00000199088]
Predicted Effect probably damaging
Transcript: ENSMUST00000031281
AA Change: L214S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031281
Gene: ENSMUSG00000029338
AA Change: L214S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
VWA 42 214 2.86e-18 SMART
Pfam:Anth_Ig 215 317 4e-38 PFAM
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 485 7.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199088
AA Change: L214S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142605
Gene: ENSMUSG00000029338
AA Change: L214S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
VWA 42 214 1.7e-20 SMART
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 483 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202736
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for null mutations display female infertility. Mice homozygous for one allele are highly resistant to Bacillus anthracis or anthrax toxin induced lethality. Young mice homozygous for a second allele display pregnancy-related premature death and failure of parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Antxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Antxr2 APN 5 97886607 splice site probably benign
IGL00661:Antxr2 APN 5 98004296 missense probably benign 0.26
IGL01105:Antxr2 APN 5 98004943 splice site probably benign
IGL01472:Antxr2 APN 5 98027499 missense probably benign 0.00
IGL01719:Antxr2 APN 5 97948273 missense possibly damaging 0.82
IGL02184:Antxr2 APN 5 97977595 splice site probably null
IGL02199:Antxr2 APN 5 97977595 splice site probably null
IGL02250:Antxr2 APN 5 97977595 splice site probably null
IGL02251:Antxr2 APN 5 97977595 splice site probably null
IGL02368:Antxr2 APN 5 97949198 missense probably damaging 1.00
IGL02447:Antxr2 APN 5 98030408 missense possibly damaging 0.61
IGL02740:Antxr2 APN 5 98030392 splice site probably benign
IGL02850:Antxr2 APN 5 98004078 missense probably damaging 1.00
IGL02867:Antxr2 APN 5 97977650 missense probably benign 0.00
IGL02889:Antxr2 APN 5 97977650 missense probably benign 0.00
R0013:Antxr2 UTSW 5 97979985 missense probably damaging 0.98
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0069:Antxr2 UTSW 5 97948250 missense possibly damaging 0.95
R0367:Antxr2 UTSW 5 98029596 missense probably benign 0.01
R0638:Antxr2 UTSW 5 97960637 nonsense probably null
R0732:Antxr2 UTSW 5 97960708 splice site probably null
R1255:Antxr2 UTSW 5 97975372 missense probably benign 0.39
R1471:Antxr2 UTSW 5 97975340 missense possibly damaging 0.88
R1520:Antxr2 UTSW 5 97960692 missense probably benign 0.38
R1660:Antxr2 UTSW 5 97975350 nonsense probably null
R1870:Antxr2 UTSW 5 98030438 missense probably damaging 1.00
R2969:Antxr2 UTSW 5 98030416 nonsense probably null
R3547:Antxr2 UTSW 5 97977657 missense probably benign 0.09
R4237:Antxr2 UTSW 5 97938407 missense probably damaging 1.00
R4660:Antxr2 UTSW 5 98004054 critical splice donor site probably null
R4702:Antxr2 UTSW 5 97949169 critical splice donor site probably null
R4893:Antxr2 UTSW 5 98004072 missense probably damaging 1.00
R4997:Antxr2 UTSW 5 97977694 missense probably benign 0.04
R5388:Antxr2 UTSW 5 97977599 critical splice donor site probably null
R5604:Antxr2 UTSW 5 97948310 missense probably damaging 0.98
R6093:Antxr2 UTSW 5 98030460 missense probably damaging 0.99
R6118:Antxr2 UTSW 5 97949201 missense probably damaging 1.00
R6130:Antxr2 UTSW 5 98004272 missense possibly damaging 0.89
R6139:Antxr2 UTSW 5 97977706 splice site probably null
R6992:Antxr2 UTSW 5 97960705 missense probably benign 0.09
R8127:Antxr2 UTSW 5 97980017 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCATTTCCCTATGAGCCTGGAGC -3'
(R):5'- TGTTAGACCCTGCGACAACACAAG -3'

Sequencing Primer
(F):5'- CCAGGTCATTAGAGCATAGAGC -3'
(R):5'- AGCTCAATGGGTAGTGGTGA -3'
Posted On2013-04-16