Incidental Mutation 'R2211:Sec31b'
ID239421
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
MMRRC Submission 040213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R2211 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44523150 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 604 (L604Q)
Ref Sequence ENSEMBL: ENSMUSP00000107616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect probably damaging
Transcript: ENSMUST00000063632
AA Change: L761Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: L761Q

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111985
AA Change: L604Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: L604Q

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165758
SMART Domains Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik T C 8: 3,387,680 S268P possibly damaging Het
Adam18 A G 8: 24,628,155 S34P probably damaging Het
Adam23 T A 1: 63,573,129 probably benign Het
Adcy10 A T 1: 165,518,212 I277F probably damaging Het
Arfgef3 A T 10: 18,592,245 S1736T possibly damaging Het
Arhgap21 A T 2: 20,881,640 M242K possibly damaging Het
Astn1 A G 1: 158,657,306 R4G probably benign Het
AU041133 G A 10: 82,150,921 C135Y probably damaging Het
Cdc42bpb A G 12: 111,301,854 V53A probably benign Het
Cdh23 T C 10: 60,466,004 D428G possibly damaging Het
Cebpa T C 7: 35,120,466 S350P probably damaging Het
Cftr A G 6: 18,214,280 M152V probably null Het
Cpa4 A G 6: 30,583,650 N255S possibly damaging Het
Ddx51 T A 5: 110,655,768 D343E probably damaging Het
Dnah7a T C 1: 53,479,773 I2942V probably benign Het
Dnajc1 G T 2: 18,392,475 A9E probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Edem3 A G 1: 151,804,702 D526G possibly damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Etaa1 G A 11: 17,952,686 Q84* probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam149a G A 8: 45,341,009 T674I probably damaging Het
Fam98a A G 17: 75,538,945 probably null Het
Fat4 A G 3: 38,891,527 N1523S possibly damaging Het
Fbxw10 A G 11: 62,867,535 T529A probably damaging Het
Gzf1 C T 2: 148,684,950 A447V probably damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hic1 T A 11: 75,169,384 R46W possibly damaging Het
Id4 T A 13: 48,261,802 L102Q probably damaging Het
Il3ra T C 14: 14,355,029 C271R probably benign Het
Ints4 T C 7: 97,509,750 I443T possibly damaging Het
Lmln A G 16: 33,109,778 E535G probably benign Het
Lrrtm4 A G 6: 80,022,640 H345R probably benign Het
Ltbp3 T C 19: 5,753,962 I834T possibly damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Mpp5 A T 12: 78,797,248 K75N possibly damaging Het
Ms4a18 C A 19: 10,997,305 V341L probably benign Het
Nbr1 T C 11: 101,567,264 probably null Het
Nf1 T C 11: 79,444,064 M914T probably benign Het
Notch3 T A 17: 32,147,978 H861L probably benign Het
Nupl1 A G 14: 60,232,640 F341L probably damaging Het
Ogfod2 C A 5: 124,112,780 probably null Het
Oit3 T C 10: 59,428,070 D414G probably damaging Het
Olfr1079 T C 2: 86,538,513 Y132C probably damaging Het
Olfr1497 T A 19: 13,795,369 M81L probably benign Het
Olfr787 A T 10: 129,462,940 K88M probably damaging Het
Olfr804 A G 10: 129,705,451 H191R probably benign Het
Pcbp4 C A 9: 106,460,734 H74Q probably benign Het
Pip5k1b A T 19: 24,378,850 D241E probably damaging Het
Plcb2 T C 2: 118,723,534 D102G probably benign Het
Plekha5 G A 6: 140,525,861 E4K possibly damaging Het
Ppargc1a A C 5: 51,474,259 S343A possibly damaging Het
Ppwd1 G A 13: 104,207,142 S585L probably benign Het
Rarg T C 15: 102,239,524 N284S probably benign Het
Rnpepl1 C T 1: 92,916,380 L278F probably damaging Het
Rp1 A C 1: 4,348,139 S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,579,904 probably benign Het
Rsph3b T C 17: 6,941,740 S189G probably benign Het
Sema6b T A 17: 56,124,741 I641F probably benign Het
Slc35f5 A T 1: 125,579,264 I309F possibly damaging Het
Smarca4 A G 9: 21,686,029 E1360G probably damaging Het
Spata31d1c T C 13: 65,035,939 S432P probably benign Het
Spsb3 T C 17: 24,890,937 probably null Het
Sptbn4 T C 7: 27,367,609 D1960G probably damaging Het
Srgap1 A G 10: 121,853,740 V345A possibly damaging Het
Tiam2 C A 17: 3,414,918 C307* probably null Het
Trim43b T A 9: 89,085,249 T444S possibly damaging Het
Trmt13 A G 3: 116,594,754 I11T probably benign Het
Ylpm1 A T 12: 85,044,378 R1073* probably null Het
Zfp524 T C 7: 5,017,919 S149P probably damaging Het
Zfp777 T C 6: 48,043,885 I312V possibly damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 intron probably null
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7983:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R8057:Sec31b UTSW 19 44519365 missense probably damaging 1.00
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATTTTCATCTGGTTTTGGACAC -3'
(R):5'- AAGTGCTTGGCAGGGATCAG -3'

Sequencing Primer
(F):5'- CTTTTGAATGGACCGATAAGCTAGC -3'
(R):5'- ATCAGGGAACGTTGGGTCTC -3'
Posted On2014-10-15