Mutagenetix > Incidental Mutation

Incidental Mutation 'R2211:Sec31b'

239421

Institutional Source

Beutler Lab

Gene Symbol

Sec31b

Ensembl Gene

ENSMUSG00000051984

Gene Name

Sec31 homolog B (S. cerevisiae)

Synonyms

LOC240667, Sec31l2

MMRRC Submission

040213-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R2211 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44516957-44545864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44523150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 604 (L604Q)

Ref Sequence

ENSEMBL: ENSMUSP00000107616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]

AlphaFold

Q3TZ89

Predicted Effect

probably damaging
Transcript: ENSMUST00000063632
AA Change: L761Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: L761Q

Domain	Start	End	E-Value	Type
Blast:WD40	56	101	5e-18	BLAST
WD40	110	150	4.76e-6	SMART
WD40	159	197	1.53e1	SMART
WD40	200	245	1.85e0	SMART
WD40	249	289	2.15e-4	SMART
WD40	292	332	6.19e-1	SMART
low complexity region	551	561	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	909	929	N/A	INTRINSIC
low complexity region	1009	1018	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111985
AA Change: L604Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: L604Q

Domain	Start	End	E-Value	Type
WD40	2	40	1.53e1	SMART
WD40	43	88	1.85e0	SMART
WD40	92	132	2.15e-4	SMART
WD40	135	175	6.19e-1	SMART
Pfam:Sec16_C	394	612	1.3e-7	PFAM
low complexity region	665	684	N/A	INTRINSIC
low complexity region	752	772	N/A	INTRINSIC
low complexity region	852	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165758

SMART Domains

Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
low complexity region	17	36	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430078G23Rik	T	C	8: 3,387,680	S268P	possibly damaging	Het
Adam18	A	G	8: 24,628,155	S34P	probably damaging	Het
Adam23	T	A	1: 63,573,129		probably benign	Het
Adcy10	A	T	1: 165,518,212	I277F	probably damaging	Het
Arfgef3	A	T	10: 18,592,245	S1736T	possibly damaging	Het
Arhgap21	A	T	2: 20,881,640	M242K	possibly damaging	Het
Astn1	A	G	1: 158,657,306	R4G	probably benign	Het
AU041133	G	A	10: 82,150,921	C135Y	probably damaging	Het
Cdc42bpb	A	G	12: 111,301,854	V53A	probably benign	Het
Cdh23	T	C	10: 60,466,004	D428G	possibly damaging	Het
Cebpa	T	C	7: 35,120,466	S350P	probably damaging	Het
Cftr	A	G	6: 18,214,280	M152V	probably null	Het
Cpa4	A	G	6: 30,583,650	N255S	possibly damaging	Het
Ddx51	T	A	5: 110,655,768	D343E	probably damaging	Het
Dnah7a	T	C	1: 53,479,773	I2942V	probably benign	Het
Dnajc1	G	T	2: 18,392,475	A9E	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Edem3	A	G	1: 151,804,702	D526G	possibly damaging	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Etaa1	G	A	11: 17,952,686	Q84*	probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam149a	G	A	8: 45,341,009	T674I	probably damaging	Het
Fam98a	A	G	17: 75,538,945		probably null	Het
Fat4	A	G	3: 38,891,527	N1523S	possibly damaging	Het
Fbxw10	A	G	11: 62,867,535	T529A	probably damaging	Het
Gzf1	C	T	2: 148,684,950	A447V	probably damaging	Het
Hap1	G	A	11: 100,354,724	T138M	probably benign	Het
Hic1	T	A	11: 75,169,384	R46W	possibly damaging	Het
Id4	T	A	13: 48,261,802	L102Q	probably damaging	Het
Il3ra	T	C	14: 14,355,029	C271R	probably benign	Het
Ints4	T	C	7: 97,509,750	I443T	possibly damaging	Het
Lmln	A	G	16: 33,109,778	E535G	probably benign	Het
Lrrtm4	A	G	6: 80,022,640	H345R	probably benign	Het
Ltbp3	T	C	19: 5,753,962	I834T	possibly damaging	Het
Mnd1	C	A	3: 84,134,109	C62F	probably benign	Het
Mpp5	A	T	12: 78,797,248	K75N	possibly damaging	Het
Ms4a18	C	A	19: 10,997,305	V341L	probably benign	Het
Nbr1	T	C	11: 101,567,264		probably null	Het
Nf1	T	C	11: 79,444,064	M914T	probably benign	Het
Notch3	T	A	17: 32,147,978	H861L	probably benign	Het
Nupl1	A	G	14: 60,232,640	F341L	probably damaging	Het
Ogfod2	C	A	5: 124,112,780		probably null	Het
Oit3	T	C	10: 59,428,070	D414G	probably damaging	Het
Olfr1079	T	C	2: 86,538,513	Y132C	probably damaging	Het
Olfr1497	T	A	19: 13,795,369	M81L	probably benign	Het
Olfr787	A	T	10: 129,462,940	K88M	probably damaging	Het
Olfr804	A	G	10: 129,705,451	H191R	probably benign	Het
Pcbp4	C	A	9: 106,460,734	H74Q	probably benign	Het
Pip5k1b	A	T	19: 24,378,850	D241E	probably damaging	Het
Plcb2	T	C	2: 118,723,534	D102G	probably benign	Het
Plekha5	G	A	6: 140,525,861	E4K	possibly damaging	Het
Ppargc1a	A	C	5: 51,474,259	S343A	possibly damaging	Het
Ppwd1	G	A	13: 104,207,142	S585L	probably benign	Het
Rarg	T	C	15: 102,239,524	N284S	probably benign	Het
Rnpepl1	C	T	1: 92,916,380	L278F	probably damaging	Het
Rp1	A	C	1: 4,348,139	S917A	probably damaging	Het
Rsf1	ATGGCG	ATGGCGAGGGTGGCG	7: 97,579,904		probably benign	Het
Rsph3b	T	C	17: 6,941,740	S189G	probably benign	Het
Sema6b	T	A	17: 56,124,741	I641F	probably benign	Het
Slc35f5	A	T	1: 125,579,264	I309F	possibly damaging	Het
Smarca4	A	G	9: 21,686,029	E1360G	probably damaging	Het
Spata31d1c	T	C	13: 65,035,939	S432P	probably benign	Het
Spsb3	T	C	17: 24,890,937		probably null	Het
Sptbn4	T	C	7: 27,367,609	D1960G	probably damaging	Het
Srgap1	A	G	10: 121,853,740	V345A	possibly damaging	Het
Tiam2	C	A	17: 3,414,918	C307*	probably null	Het
Trim43b	T	A	9: 89,085,249	T444S	possibly damaging	Het
Trmt13	A	G	3: 116,594,754	I11T	probably benign	Het
Ylpm1	A	T	12: 85,044,378	R1073*	probably null	Het
Zfp524	T	C	7: 5,017,919	S149P	probably damaging	Het
Zfp777	T	C	6: 48,043,885	I312V	possibly damaging	Het

Other mutations in Sec31b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Sec31b	APN	19	44527041	missense	probably damaging	1.00
IGL01308:Sec31b	APN	19	44523683	missense	probably benign	0.02
IGL02404:Sec31b	APN	19	44534788	missense	probably damaging	0.99
IGL02663:Sec31b	APN	19	44534278	missense	probably damaging	1.00
IGL02728:Sec31b	APN	19	44523115	missense	probably damaging	0.96
IGL02830:Sec31b	APN	19	44531703	missense	probably damaging	1.00
IGL03141:Sec31b	APN	19	44526320	splice site	probably benign
IGL03247:Sec31b	APN	19	44518940	missense	possibly damaging	0.62
R0049:Sec31b	UTSW	19	44520408	splice site	probably benign
R0137:Sec31b	UTSW	19	44534382	missense	probably damaging	1.00
R0238:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0239:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0468:Sec31b	UTSW	19	44518508	splice site	probably benign
R0504:Sec31b	UTSW	19	44534786	missense	probably damaging	1.00
R0565:Sec31b	UTSW	19	44524553	missense	probably damaging	1.00
R0627:Sec31b	UTSW	19	44525607	missense	probably benign
R0749:Sec31b	UTSW	19	44524506	missense	probably damaging	0.96
R0815:Sec31b	UTSW	19	44518173	nonsense	probably null
R1162:Sec31b	UTSW	19	44517648	nonsense	probably null
R1398:Sec31b	UTSW	19	44523665	missense	probably benign	0.04
R1436:Sec31b	UTSW	19	44536195	missense	probably damaging	0.99
R1538:Sec31b	UTSW	19	44518586	missense	probably benign	0.42
R1599:Sec31b	UTSW	19	44523153	missense	possibly damaging	0.92
R2044:Sec31b	UTSW	19	44536156	missense	probably benign	0.07
R2135:Sec31b	UTSW	19	44534696	missense	probably damaging	0.99
R2167:Sec31b	UTSW	19	44543353	missense	possibly damaging	0.89
R2938:Sec31b	UTSW	19	44536179	missense	probably damaging	0.99
R3113:Sec31b	UTSW	19	44518185	nonsense	probably null
R4110:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4111:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4113:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4158:Sec31b	UTSW	19	44525186	missense	probably benign	0.34
R4226:Sec31b	UTSW	19	44531710	missense	probably benign
R4646:Sec31b	UTSW	19	44526621	missense	probably benign	0.00
R4732:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4733:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4795:Sec31b	UTSW	19	44531746	missense	probably benign	0.00
R4877:Sec31b	UTSW	19	44535733	missense	probably damaging	1.00
R5150:Sec31b	UTSW	19	44520531	missense	probably benign	0.08
R5377:Sec31b	UTSW	19	44518637	missense	probably damaging	1.00
R5381:Sec31b	UTSW	19	44534371	missense	probably damaging	1.00
R5708:Sec31b	UTSW	19	44523144	missense	probably damaging	1.00
R6002:Sec31b	UTSW	19	44535764	missense	probably benign	0.04
R6185:Sec31b	UTSW	19	44543284	missense	possibly damaging	0.77
R6675:Sec31b	UTSW	19	44523775	missense	probably benign
R6946:Sec31b	UTSW	19	44534316	missense	probably damaging	1.00
R7139:Sec31b	UTSW	19	44518936	missense	probably benign	0.00
R7237:Sec31b	UTSW	19	44517708	missense	probably damaging	1.00
R7270:Sec31b	UTSW	19	44523043	missense	probably benign	0.00
R7340:Sec31b	UTSW	19	44528722	missense	probably benign	0.00
R7505:Sec31b	UTSW	19	44543707	missense	probably damaging	1.00
R7584:Sec31b	UTSW	19	44543323	missense	probably damaging	0.99
R7584:Sec31b	UTSW	19	44531556	splice site	probably null
R7763:Sec31b	UTSW	19	44523835	critical splice acceptor site	probably null
R7777:Sec31b	UTSW	19	44523773	nonsense	probably null
R7900:Sec31b	UTSW	19	44526230	missense	probably damaging	1.00
R7952:Sec31b	UTSW	19	44520540	missense	probably benign	0.01
R8057:Sec31b	UTSW	19	44519365	missense	probably damaging	1.00
R8197:Sec31b	UTSW	19	44524516	missense	probably benign	0.25
R8739:Sec31b	UTSW	19	44519181	missense	probably benign	0.16
R8822:Sec31b	UTSW	19	44519263	missense	probably benign	0.02
R8837:Sec31b	UTSW	19	44517667	nonsense	probably null
R8916:Sec31b	UTSW	19	44532344	missense
R9069:Sec31b	UTSW	19	44519302	missense	probably damaging	0.98
R9259:Sec31b	UTSW	19	44517416	missense	probably damaging	1.00
R9493:Sec31b	UTSW	19	44520582	missense	probably damaging	1.00
RF023:Sec31b	UTSW	19	44535787	missense	probably damaging	1.00
Z1177:Sec31b	UTSW	19	44517314	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAATTTTCATCTGGTTTTGGACAC -3'
(R):5'- AAGTGCTTGGCAGGGATCAG -3'

Sequencing Primer
(F):5'- CTTTTGAATGGACCGATAAGCTAGC -3'
(R):5'- ATCAGGGAACGTTGGGTCTC -3'

Posted On

2014-10-15