Mutagenetix > Incidental Mutations

Incidental Mutation 'R2212:Il18r1'

239423

Institutional Source

Beutler Lab

Gene Symbol

Il18r1

Ensembl Gene

ENSMUSG00000026070

Gene Name

interleukin 18 receptor 1

Synonyms

Il18ralpha, Il1rrp

MMRRC Submission

040214-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2212 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

40465552-40500854 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 40491067 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 318 (D318V)

Ref Sequence

ENSEMBL: ENSMUSP00000142070 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000167723] [ENSMUST00000193391] [ENSMUST00000193793] [ENSMUST00000195684]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087983
AA Change: D318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: D318V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC
TIR	371	519	3.8e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108044
AA Change: D318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: D318V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC
TIR	371	519	3.8e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167723
AA Change: D318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128277
Gene: ENSMUSG00000026070
AA Change: D318V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193391
AA Change: D318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141695
Gene: ENSMUSG00000026070
AA Change: D318V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193793

SMART Domains

Protein: ENSMUSP00000141464
Gene: ENSMUSG00000026070

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	3.7e-3	SMART
IG_like	132	189	9.7e-3	SMART
Pfam:Ig_2	214	263	5.2e-1	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000195684
AA Change: D318V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: D318V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC
TIR	371	519	3.8e-37	SMART

Meta Mutation Damage Score

0.5528

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	A	G	18: 24,470,920	Y6C	probably damaging	Het
3425401B19Rik	T	A	14: 32,661,602	Q802L	probably benign	Het
Adarb2	T	C	13: 8,752,618	F643S	probably damaging	Het
Angptl4	A	G	17: 33,775,418	I401T	probably damaging	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Atp8b4	C	A	2: 126,375,757	W613L	probably damaging	Het
Coq10a	A	G	10: 128,365,129	V93A	possibly damaging	Het
Cyp4f39	A	T	17: 32,487,063	E376V	possibly damaging	Het
Deup1	A	T	9: 15,599,843	D213E	probably benign	Het
Ehmt2	A	G	17: 34,899,365	S39G	probably benign	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Fam92a	A	G	4: 12,171,696		probably null	Het
Fcna	G	C	2: 25,627,493	P49A	probably damaging	Het
Flnb	AAGGAG	AAG	14: 7,881,652		probably benign	Het
Fscn2	G	T	11: 120,361,591		probably benign	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Golgb1	A	G	16: 36,887,347	K68E	probably damaging	Het
H2-M11	G	A	17: 36,548,930	V272M	probably damaging	Het
Hace1	T	A	10: 45,648,675	D234E	possibly damaging	Het
Il4i1	T	C	7: 44,836,658	L22P	probably damaging	Het
Kcnq3	A	T	15: 66,020,293	F411Y	probably benign	Het
Kcnt2	A	G	1: 140,530,800	Y775C	probably damaging	Het
Krt84	A	C	15: 101,532,538	V73G	probably benign	Het
Lcp2	A	C	11: 34,070,995	D117A	probably benign	Het
Lemd1	C	A	1: 132,228,286	T22K	probably benign	Het
Mdm4	T	C	1: 132,994,522	D294G	probably damaging	Het
Mep1a	G	A	17: 43,477,263	A634V	probably benign	Het
Myh15	A	G	16: 49,138,732	D989G	probably benign	Het
Myo1g	G	T	11: 6,517,870	H188Q	possibly damaging	Het
Nsmaf	C	A	4: 6,396,732	L918F	probably damaging	Het
Olfr1396	C	T	11: 49,113,216	C170Y	probably damaging	Het
Olfr561	T	C	7: 102,774,755	L77P	possibly damaging	Het
Olfr635	T	C	7: 103,979,402	L76P	probably damaging	Het
Olfr963	T	A	9: 39,669,228	M57K	probably damaging	Het
Pfkfb2	A	T	1: 130,707,532	N97K	probably damaging	Het
Phlda1	A	T	10: 111,507,168	E255V	probably damaging	Het
Pla2g4f	T	C	2: 120,303,106	S579G	probably benign	Het
Plcz1	C	T	6: 140,002,081	R525Q	probably damaging	Het
Ppargc1b	G	A	18: 61,311,220	Q291*	probably null	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Ppp1r3b	A	G	8: 35,384,225	T73A	possibly damaging	Het
Prss43	G	C	9: 110,829,464	Q277H	probably damaging	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Serpina3j	G	A	12: 104,314,726	D53N	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Spata13	A	G	14: 60,706,723	T522A	probably benign	Het
Spryd3	A	G	15: 102,130,276		probably null	Het
Sry	T	A	Y: 2,663,339	N107I	probably damaging	Het
St6galnac1	A	G	11: 116,765,856	W486R	probably damaging	Het
Syt1	G	T	10: 108,504,414	P348T	possibly damaging	Het
Taok2	T	C	7: 126,870,858	I933V	possibly damaging	Het
Tex9	C	A	9: 72,477,758	Q265H	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trim59	T	C	3: 69,037,543	T155A	probably benign	Het
Trim69	T	C	2: 122,178,644	V395A	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubash3a	A	T	17: 31,218,034	Q208H	probably damaging	Het
Ubn2	A	G	6: 38,498,739	T1211A	probably benign	Het
Vmn2r110	A	T	17: 20,573,947		probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Il18r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Il18r1	APN	1	40498652	missense	possibly damaging	0.68
IGL00742:Il18r1	APN	1	40480991	missense	probably benign	0.11
IGL01448:Il18r1	APN	1	40474730	missense	probably damaging	1.00
IGL01726:Il18r1	APN	1	40498403	missense	possibly damaging	0.83
IGL02081:Il18r1	APN	1	40498505	missense	probably damaging	1.00
IGL02425:Il18r1	APN	1	40491221	splice site	probably benign
IGL02447:Il18r1	APN	1	40498337	critical splice acceptor site	probably null
IGL02529:Il18r1	APN	1	40487059	missense	possibly damaging	0.77
IGL02863:Il18r1	APN	1	40487007	missense	probably damaging	1.00
IGL02928:Il18r1	APN	1	40478551	critical splice donor site	probably null
IGL02941:Il18r1	APN	1	40498551	missense	probably damaging	0.99
IGL03156:Il18r1	APN	1	40498368	missense	possibly damaging	0.92
R0532:Il18r1	UTSW	1	40474901	missense	probably damaging	0.97
R0926:Il18r1	UTSW	1	40487028	missense	probably damaging	1.00
R1909:Il18r1	UTSW	1	40474914	missense	probably damaging	1.00
R2254:Il18r1	UTSW	1	40491220	missense	possibly damaging	0.91
R2860:Il18r1	UTSW	1	40498557	missense	possibly damaging	0.49
R2861:Il18r1	UTSW	1	40498557	missense	possibly damaging	0.49
R2862:Il18r1	UTSW	1	40498557	missense	possibly damaging	0.49
R3412:Il18r1	UTSW	1	40491067	missense	probably damaging	1.00
R3432:Il18r1	UTSW	1	40487089	missense	probably damaging	0.99
R3718:Il18r1	UTSW	1	40495788	missense	probably benign	0.00
R3816:Il18r1	UTSW	1	40486972	splice site	probably benign
R3894:Il18r1	UTSW	1	40474874	missense	possibly damaging	0.79
R4061:Il18r1	UTSW	1	40474936	missense	probably benign	0.33
R4062:Il18r1	UTSW	1	40474936	missense	probably benign	0.33
R4381:Il18r1	UTSW	1	40471790	missense	probably benign	0.00
R4972:Il18r1	UTSW	1	40491064	missense	probably benign	0.39
R5059:Il18r1	UTSW	1	40481067	critical splice donor site	probably null
R6229:Il18r1	UTSW	1	40474763	missense	probably benign	0.02
R6458:Il18r1	UTSW	1	40491182	nonsense	probably null
R6505:Il18r1	UTSW	1	40489707	missense	probably benign
R6738:Il18r1	UTSW	1	40498656	missense	probably benign	0.06
R7002:Il18r1	UTSW	1	40474853	missense	probably benign	0.39
R7317:Il18r1	UTSW	1	40474832	missense	possibly damaging	0.80
R7485:Il18r1	UTSW	1	40480980	missense	probably benign	0.01
R7510:Il18r1	UTSW	1	40474875	missense	probably benign	0.03
R7515:Il18r1	UTSW	1	40498670	missense	not run
R7526:Il18r1	UTSW	1	40471772	missense	probably damaging	0.99
R7793:Il18r1	UTSW	1	40471764	missense	probably benign	0.01
R7870:Il18r1	UTSW	1	40491136	missense	probably benign	0.45
R8004:Il18r1	UTSW	1	40474757	missense	probably damaging	1.00
R8063:Il18r1	UTSW	1	40487038	missense	probably benign	0.10
X0023:Il18r1	UTSW	1	40471761	missense	probably benign	0.04
X0064:Il18r1	UTSW	1	40495713	splice site	probably null
Z1088:Il18r1	UTSW	1	40474751	missense	probably damaging	1.00
Z1088:Il18r1	UTSW	1	40478486	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTCCCACTGTAGACTACCAGCAG -3'
(R):5'- AAACATGAGCTAGGGTGCCC -3'

Sequencing Primer
(F):5'- CTGTAGACTACCAGCAGGAGTGTG -3'
(R):5'- CCTGTCACAGCAGCATATTACCTG -3'

Posted On

2014-10-15