Incidental Mutation 'R2212:Pfkfb2'
ID239424
Institutional Source Beutler Lab
Gene Symbol Pfkfb2
Ensembl Gene ENSMUSG00000026409
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms4930568D07Rik, PFK-2/FBPase-2 gene B
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130689182-130729253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130707532 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 97 (N97K)
Ref Sequence ENSEMBL: ENSMUSP00000140698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
Predicted Effect probably damaging
Transcript: ENSMUST00000050406
AA Change: N97K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066863
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169659
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171479
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185233
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably damaging
Transcript: ENSMUST00000187089
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188520
AA Change: N97K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189167
AA Change: N97K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189534
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191301
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191347
AA Change: N97K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409
AA Change: N97K

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Pfkfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Pfkfb2 APN 1 130705370 splice site probably benign
IGL02273:Pfkfb2 APN 1 130707582 missense probably damaging 1.00
IGL02369:Pfkfb2 APN 1 130700835 missense probably damaging 0.99
IGL02469:Pfkfb2 APN 1 130700037 missense probably damaging 1.00
IGL02490:Pfkfb2 APN 1 130700852 missense probably damaging 1.00
R0080:Pfkfb2 UTSW 1 130714542 missense probably benign 0.20
R0616:Pfkfb2 UTSW 1 130706422 splice site probably null
R1458:Pfkfb2 UTSW 1 130708190 missense possibly damaging 0.89
R1490:Pfkfb2 UTSW 1 130697889 intron probably null
R1548:Pfkfb2 UTSW 1 130698083 missense probably benign
R1554:Pfkfb2 UTSW 1 130706472 missense probably damaging 1.00
R2143:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2144:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2145:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2938:Pfkfb2 UTSW 1 130705410 missense possibly damaging 0.95
R4650:Pfkfb2 UTSW 1 130705463 missense possibly damaging 0.67
R4683:Pfkfb2 UTSW 1 130706484 critical splice acceptor site probably null
R5153:Pfkfb2 UTSW 1 130701790 missense probably damaging 1.00
R5914:Pfkfb2 UTSW 1 130700095 missense probably damaging 1.00
R5976:Pfkfb2 UTSW 1 130708079 nonsense probably null
R6194:Pfkfb2 UTSW 1 130697887 makesense probably null
R6285:Pfkfb2 UTSW 1 130707562 nonsense probably null
R6956:Pfkfb2 UTSW 1 130707600 missense probably damaging 1.00
R6971:Pfkfb2 UTSW 1 130700796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCAACCTAAGCTGGTC -3'
(R):5'- GTAGAACCTCAGCTCTTCTCG -3'

Sequencing Primer
(F):5'- CAACCTAAGCTGGTCTTTCAATCTAG -3'
(R):5'- AGCTCTTCTCGTAAGTCAGGAC -3'
Posted On2014-10-15