Incidental Mutation 'R2212:Mdm4'
ID239426
Institutional Source Beutler Lab
Gene Symbol Mdm4
Ensembl Gene ENSMUSG00000054387
Gene Nametransformed mouse 3T3 cell double minute 4
Synonyms4933417N07Rik, Mdmx
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132959484-133030561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132994522 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 294 (D294G)
Ref Sequence ENSEMBL: ENSMUSP00000140609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067398] [ENSMUST00000067429] [ENSMUST00000185398] [ENSMUST00000186617] [ENSMUST00000188090] [ENSMUST00000191212]
Predicted Effect probably benign
Transcript: ENSMUST00000067398
AA Change: D295G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068661
Gene: ENSMUSG00000054387
AA Change: D295G

DomainStartEndE-ValueType
Pfam:SWIB 26 96 3.7e-10 PFAM
low complexity region 281 295 N/A INTRINSIC
ZnF_RBZ 302 326 1.65e-2 SMART
RING 437 477 7.26e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067429
AA Change: D294G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070411
Gene: ENSMUSG00000054387
AA Change: D294G

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185398
SMART Domains Protein: ENSMUSP00000140090
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186513
Predicted Effect probably benign
Transcript: ENSMUST00000186617
AA Change: D294G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140812
Gene: ENSMUSG00000054387
AA Change: D294G

DomainStartEndE-ValueType
Pfam:SWIB 26 101 9.9e-15 PFAM
low complexity region 280 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188090
AA Change: D294G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140609
Gene: ENSMUSG00000054387
AA Change: D294G

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190312
Predicted Effect probably benign
Transcript: ENSMUST00000191212
SMART Domains Protein: ENSMUSP00000140006
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.4e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, decreased cellular proliferation, and abnormal nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Mdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Mdm4 APN 1 132994547 missense probably benign 0.02
IGL03034:Mdm4 APN 1 133011071 missense probably damaging 1.00
IGL03099:Mdm4 APN 1 132992209 missense probably damaging 1.00
Isla_nublar UTSW 1 133012692 missense probably damaging 1.00
jurassic UTSW 1 133011115 missense probably damaging 0.96
Sun_island UTSW 1 133012651 missense probably damaging 1.00
R0630:Mdm4 UTSW 1 132991753 missense possibly damaging 0.47
R1170:Mdm4 UTSW 1 132991820 missense probably damaging 1.00
R1170:Mdm4 UTSW 1 133012692 missense probably damaging 1.00
R1774:Mdm4 UTSW 1 132996646 missense probably damaging 0.99
R1920:Mdm4 UTSW 1 133003800 missense probably benign 0.06
R2061:Mdm4 UTSW 1 133012651 missense probably damaging 1.00
R3695:Mdm4 UTSW 1 132991993 missense probably benign 0.00
R3919:Mdm4 UTSW 1 132994568 missense possibly damaging 0.94
R5273:Mdm4 UTSW 1 132994582 missense probably benign
R5360:Mdm4 UTSW 1 132991658 makesense probably null
R6125:Mdm4 UTSW 1 132994510 missense possibly damaging 0.95
R6153:Mdm4 UTSW 1 132992107 missense probably damaging 1.00
R7028:Mdm4 UTSW 1 133003809 missense probably benign 0.09
R7234:Mdm4 UTSW 1 133011115 missense probably damaging 0.96
R7267:Mdm4 UTSW 1 132994573 missense probably benign 0.00
Z1088:Mdm4 UTSW 1 132994547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAGTTGTGTTAGCAGGGAC -3'
(R):5'- GAACACCTCTTTCTGAATAGAGAAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- AGAGAAGGTATTTAGTAGCCCTGTG -3'
Posted On2014-10-15