Mutagenetix > Incidental Mutations

Incidental Mutation 'R2212:Kcnt2'

239427

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

040214-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R2212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140530800 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 775 (Y775C)

Ref Sequence

ENSEMBL: ENSMUSP00000113333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060201
AA Change: Y782C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000054623
Gene: ENSMUSG00000052726
AA Change: Y782C

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	424	533	1.3e-31	PFAM
low complexity region	655	670	N/A	INTRINSIC
low complexity region	677	689	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119786

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120709

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120796
AA Change: Y775C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: Y775C

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193606

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	A	G	18: 24,470,920	Y6C	probably damaging	Het
3425401B19Rik	T	A	14: 32,661,602	Q802L	probably benign	Het
Adarb2	T	C	13: 8,752,618	F643S	probably damaging	Het
Angptl4	A	G	17: 33,775,418	I401T	probably damaging	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Atp8b4	C	A	2: 126,375,757	W613L	probably damaging	Het
Coq10a	A	G	10: 128,365,129	V93A	possibly damaging	Het
Cyp4f39	A	T	17: 32,487,063	E376V	possibly damaging	Het
Deup1	A	T	9: 15,599,843	D213E	probably benign	Het
Ehmt2	A	G	17: 34,899,365	S39G	probably benign	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Fam92a	A	G	4: 12,171,696		probably null	Het
Fcna	G	C	2: 25,627,493	P49A	probably damaging	Het
Flnb	AAGGAG	AAG	14: 7,881,652		probably benign	Het
Fscn2	G	T	11: 120,361,591		probably benign	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Golgb1	A	G	16: 36,887,347	K68E	probably damaging	Het
H2-M11	G	A	17: 36,548,930	V272M	probably damaging	Het
Hace1	T	A	10: 45,648,675	D234E	possibly damaging	Het
Il18r1	A	T	1: 40,491,067	D318V	probably damaging	Het
Il4i1	T	C	7: 44,836,658	L22P	probably damaging	Het
Kcnq3	A	T	15: 66,020,293	F411Y	probably benign	Het
Krt84	A	C	15: 101,532,538	V73G	probably benign	Het
Lcp2	A	C	11: 34,070,995	D117A	probably benign	Het
Lemd1	C	A	1: 132,228,286	T22K	probably benign	Het
Mdm4	T	C	1: 132,994,522	D294G	probably damaging	Het
Mep1a	G	A	17: 43,477,263	A634V	probably benign	Het
Myh15	A	G	16: 49,138,732	D989G	probably benign	Het
Myo1g	G	T	11: 6,517,870	H188Q	possibly damaging	Het
Nsmaf	C	A	4: 6,396,732	L918F	probably damaging	Het
Olfr1396	C	T	11: 49,113,216	C170Y	probably damaging	Het
Olfr561	T	C	7: 102,774,755	L77P	possibly damaging	Het
Olfr635	T	C	7: 103,979,402	L76P	probably damaging	Het
Olfr963	T	A	9: 39,669,228	M57K	probably damaging	Het
Pfkfb2	A	T	1: 130,707,532	N97K	probably damaging	Het
Phlda1	A	T	10: 111,507,168	E255V	probably damaging	Het
Pla2g4f	T	C	2: 120,303,106	S579G	probably benign	Het
Plcz1	C	T	6: 140,002,081	R525Q	probably damaging	Het
Ppargc1b	G	A	18: 61,311,220	Q291*	probably null	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Ppp1r3b	A	G	8: 35,384,225	T73A	possibly damaging	Het
Prss43	G	C	9: 110,829,464	Q277H	probably damaging	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Serpina3j	G	A	12: 104,314,726	D53N	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Spata13	A	G	14: 60,706,723	T522A	probably benign	Het
Spryd3	A	G	15: 102,130,276		probably null	Het
Sry	T	A	Y: 2,663,339	N107I	probably damaging	Het
St6galnac1	A	G	11: 116,765,856	W486R	probably damaging	Het
Syt1	G	T	10: 108,504,414	P348T	possibly damaging	Het
Taok2	T	C	7: 126,870,858	I933V	possibly damaging	Het
Tex9	C	A	9: 72,477,758	Q265H	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trim59	T	C	3: 69,037,543	T155A	probably benign	Het
Trim69	T	C	2: 122,178,644	V395A	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubash3a	A	T	17: 31,218,034	Q208H	probably damaging	Het
Ubn2	A	G	6: 38,498,739	T1211A	probably benign	Het
Vmn2r110	A	T	17: 20,573,947		probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCAAGTGAAAGGGCAACTTAG -3'
(R):5'- CAGCAATGGAATACAGCTTAGCAG -3'

Sequencing Primer
(F):5'- AAGGGCAACTTAGGATGTATCTTGTC -3'
(R):5'- CTTAGCAGTATGGTAGGGGGTACAC -3'

Posted On

2014-10-15