Incidental Mutation 'R2212:Nsmaf'
ID239435
Institutional Source Beutler Lab
Gene Symbol Nsmaf
Ensembl Gene ENSMUSG00000028245
Gene Nameneutral sphingomyelinase (N-SMase) activation associated factor
SynonymsFan, factor associated with N-SMase activation
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location6396207-6454271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6396732 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 918 (L918F)
Ref Sequence ENSEMBL: ENSMUSP00000029910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374] [ENSMUST00000153861] [ENSMUST00000175769]
Predicted Effect probably damaging
Transcript: ENSMUST00000029910
AA Change: L918F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245
AA Change: L918F

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029912
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103008
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108374
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149015
Predicted Effect probably benign
Transcript: ENSMUST00000153861
SMART Domains Protein: ENSMUSP00000119838
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156715
Predicted Effect probably benign
Transcript: ENSMUST00000175769
SMART Domains Protein: ENSMUSP00000135777
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
Blast:PDZ 208 249 1e-21 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation show no gross phenotypic abnormalities but display delayed cutaneous barrier repair. In addition, D-galactosamine-sensitized homozygotes are partially resistant to LPS- and TNF-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Nsmaf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Nsmaf APN 4 6417163 critical splice donor site probably null
IGL00778:Nsmaf APN 4 6435056 critical splice donor site probably null
IGL01775:Nsmaf APN 4 6396791 missense possibly damaging 0.79
IGL02003:Nsmaf APN 4 6418522 missense probably benign 0.02
IGL02039:Nsmaf APN 4 6424995 splice site probably benign
IGL02085:Nsmaf APN 4 6398551 missense probably benign 0.21
IGL02252:Nsmaf APN 4 6398378 missense probably benign 0.00
IGL02655:Nsmaf APN 4 6424933 missense possibly damaging 0.94
R0023:Nsmaf UTSW 4 6408680 missense probably damaging 0.96
R0454:Nsmaf UTSW 4 6424874 splice site probably null
R0538:Nsmaf UTSW 4 6419930 splice site probably null
R0605:Nsmaf UTSW 4 6418470 critical splice donor site probably null
R1033:Nsmaf UTSW 4 6438054 missense probably damaging 1.00
R1472:Nsmaf UTSW 4 6423448 nonsense probably null
R1519:Nsmaf UTSW 4 6438062 missense probably benign 0.06
R1641:Nsmaf UTSW 4 6409884 missense probably benign 0.01
R1668:Nsmaf UTSW 4 6398880 missense probably damaging 0.98
R2351:Nsmaf UTSW 4 6437921 missense probably damaging 1.00
R3862:Nsmaf UTSW 4 6435064 missense probably benign 0.00
R4112:Nsmaf UTSW 4 6417188 nonsense probably null
R4644:Nsmaf UTSW 4 6419940 splice site probably benign
R4807:Nsmaf UTSW 4 6398542 splice site probably null
R4960:Nsmaf UTSW 4 6423342 missense probably damaging 1.00
R5556:Nsmaf UTSW 4 6398621 missense probably benign 0.00
R5936:Nsmaf UTSW 4 6421017 intron probably benign
R7288:Nsmaf UTSW 4 6416641 missense probably benign
R7295:Nsmaf UTSW 4 6438083 missense probably benign 0.00
R7378:Nsmaf UTSW 4 6416586 missense probably benign
R7615:Nsmaf UTSW 4 6408563 missense probably damaging 1.00
X0021:Nsmaf UTSW 4 6398543 critical splice donor site probably null
X0063:Nsmaf UTSW 4 6414962 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTAGTCTTCAAACTGTTGTC -3'
(R):5'- TAATAGGAGCGCGGGTATGC -3'

Sequencing Primer
(F):5'- GCTTAATGGATGACAACAAATGGCTC -3'
(R):5'- CTGATTACCTCCTATGGCAGGCAG -3'
Posted On2014-10-15