Incidental Mutation 'R2212:Vrk3'
ID239447
Institutional Source Beutler Lab
Gene Symbol Vrk3
Ensembl Gene ENSMUSG00000002205
Gene Namevaccinia related kinase 3
Synonyms
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44748413-44777515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44775442 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 427 (T427M)
Ref Sequence ENSEMBL: ENSMUSP00000002275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002275] [ENSMUST00000147952]
Predicted Effect probably benign
Transcript: ENSMUST00000002275
AA Change: T427M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000002275
Gene: ENSMUSG00000002205
AA Change: T427M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 212 432 3.2e-8 PFAM
Pfam:Pkinase 218 432 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147952
SMART Domains Protein: ENSMUSP00000130331
Gene: ENSMUSG00000002205

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.1e-11 PFAM
Pfam:zinc_ribbon_2 4 26 2.9e-10 PFAM
PDB:2JII|B 117 162 1e-8 PDB
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. In both human and mouse, this gene has substitutions at several residues within the ATP binding motifs that in other kinases have been shown to be required for catalysis. In vitro assays indicate the protein lacks phosphorylation activity. The protein, however, likely retains its substrate binding capability. This gene is widely expressed in human tissues and its protein localizes to the nucleus. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired social behavior, decreased fear and anxiety relate behavior, impaired spatial memory, and abnormal hippocampal dendritic spine and synapse morphologies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Vrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Vrk3 APN 7 44769647 missense probably damaging 1.00
IGL01540:Vrk3 APN 7 44767144 missense probably damaging 1.00
IGL02682:Vrk3 APN 7 44753820 missense probably benign 0.19
R0462:Vrk3 UTSW 7 44764200 missense possibly damaging 0.77
R0831:Vrk3 UTSW 7 44764803 missense probably damaging 1.00
R1760:Vrk3 UTSW 7 44768471 missense probably damaging 0.98
R2289:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2915:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3027:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3028:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3416:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3417:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3613:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3877:Vrk3 UTSW 7 44763036 unclassified probably null
R4357:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4359:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4379:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4381:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4439:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4441:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4773:Vrk3 UTSW 7 44775476 missense probably benign
R5222:Vrk3 UTSW 7 44759796 missense possibly damaging 0.67
R5808:Vrk3 UTSW 7 44759874 missense probably damaging 0.96
R6180:Vrk3 UTSW 7 44769611 missense possibly damaging 0.50
R7007:Vrk3 UTSW 7 44757763 missense probably damaging 0.97
R7058:Vrk3 UTSW 7 44768466 missense probably damaging 0.98
R7425:Vrk3 UTSW 7 44770924 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGTTTACCATTCCACTGCTG -3'
(R):5'- TGAATTGACTTCAGGAGCTGATG -3'

Sequencing Primer
(F):5'- CTTGATGCTTCCCACACCGAC -3'
(R):5'- TTGACTTCAGGAGCTGATGAAAAACC -3'
Posted On2014-10-15