Incidental Mutation 'R2212:Deup1'
ID239456
Institutional Source Beutler Lab
Gene Symbol Deup1
Ensembl Gene ENSMUSG00000039977
Gene Namedeuterosome assembly protein 1
SynonymsCcdc67, 4933401K09Rik
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15559864-15627933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15599843 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 213 (D213E)
Ref Sequence ENSEMBL: ENSMUSP00000121526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045513] [ENSMUST00000115592] [ENSMUST00000115593] [ENSMUST00000152377]
Predicted Effect probably benign
Transcript: ENSMUST00000045513
AA Change: D213E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000039912
Gene: ENSMUSG00000039977
AA Change: D213E

DomainStartEndE-ValueType
Pfam:CEP63 11 279 7.7e-92 PFAM
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
coiled coil region 555 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115592
AA Change: D213E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111255
Gene: ENSMUSG00000039977
AA Change: D213E

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115593
AA Change: D213E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111256
Gene: ENSMUSG00000039977
AA Change: D213E

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152377
AA Change: D213E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121526
Gene: ENSMUSG00000039977
AA Change: D213E

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Deup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Deup1 APN 9 15561370 missense probably damaging 0.96
IGL00927:Deup1 APN 9 15610671 splice site probably benign
IGL00946:Deup1 APN 9 15561238 missense possibly damaging 0.62
IGL02458:Deup1 APN 9 15592360 missense probably benign 0.02
IGL02567:Deup1 APN 9 15575283 missense probably damaging 1.00
IGL03089:Deup1 APN 9 15607800 missense possibly damaging 0.62
IGL03220:Deup1 APN 9 15592411 missense probably benign 0.38
IGL03147:Deup1 UTSW 9 15610614 missense probably damaging 0.99
PIT4468001:Deup1 UTSW 9 15564005 missense possibly damaging 0.79
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0324:Deup1 UTSW 9 15582533 missense probably benign 0.01
R0539:Deup1 UTSW 9 15582597 missense possibly damaging 0.51
R0835:Deup1 UTSW 9 15599751 missense probably damaging 1.00
R1666:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R2237:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2238:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2423:Deup1 UTSW 9 15592458 nonsense probably null
R2929:Deup1 UTSW 9 15575188 missense probably benign 0.03
R3890:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R3892:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R4941:Deup1 UTSW 9 15588027 missense probably benign
R4959:Deup1 UTSW 9 15612014 nonsense probably null
R4960:Deup1 UTSW 9 15600968 missense possibly damaging 0.87
R4968:Deup1 UTSW 9 15592428 missense probably damaging 0.99
R4973:Deup1 UTSW 9 15612014 nonsense probably null
R5195:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R5231:Deup1 UTSW 9 15575199 missense probably damaging 0.96
R5470:Deup1 UTSW 9 15582620 splice site probably null
R5931:Deup1 UTSW 9 15561322 missense possibly damaging 0.55
R6049:Deup1 UTSW 9 15561256 missense possibly damaging 0.75
R6373:Deup1 UTSW 9 15561342 missense probably damaging 0.99
R6516:Deup1 UTSW 9 15610614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGTTGACAGTGCATTGGC -3'
(R):5'- ACCTGGACTGTATAAGCCAAACTC -3'

Sequencing Primer
(F):5'- GTCCCGCCCATCAGTAATG -3'
(R):5'- TGGACTGTATAAGCCAAACTCCATAC -3'
Posted On2014-10-15