Incidental Mutation 'R2212:Myo1g'
ID239464
Institutional Source Beutler Lab
Gene Symbol Myo1g
Ensembl Gene ENSMUSG00000020437
Gene Namemyosin IG
Synonyms
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6506548-6520965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6517870 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 188 (H188Q)
Ref Sequence ENSEMBL: ENSMUSP00000003459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003459] [ENSMUST00000134489] [ENSMUST00000144725] [ENSMUST00000146536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003459
AA Change: H188Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003459
Gene: ENSMUSG00000020437
AA Change: H188Q

DomainStartEndE-ValueType
MYSc 9 714 N/A SMART
IQ 715 737 2.79e0 SMART
Pfam:Myosin_TH1 821 1024 2.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131823
Predicted Effect probably benign
Transcript: ENSMUST00000134489
SMART Domains Protein: ENSMUSP00000122356
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Pfam:Myosin_head 51 99 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144725
SMART Domains Protein: ENSMUSP00000120975
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Blast:MYSc 9 43 8e-14 BLAST
low complexity region 48 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146536
SMART Domains Protein: ENSMUSP00000122438
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Blast:MYSc 9 38 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156878
Meta Mutation Damage Score 0.1213 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYO1G is a plasma membrane-associated class I myosin (see MIM 601478) that is abundant in T and B lymphocytes and mast cells (Pierce et al., 2001 [PubMed 11544309]; Patino-Lopez et al., 2010 [PubMed 20071333]).[supplied by OMIM, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cell spreading, migration and homing and impaired T cell motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Myo1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Myo1g APN 11 6515856 missense possibly damaging 0.70
IGL01608:Myo1g APN 11 6516780 missense possibly damaging 0.61
IGL01679:Myo1g APN 11 6518006 missense possibly damaging 0.90
IGL01830:Myo1g APN 11 6514522 nonsense probably null
IGL02332:Myo1g APN 11 6520766 missense possibly damaging 0.61
IGL02813:Myo1g APN 11 6518743 makesense probably null
IGL02988:Myo1g APN 11 6508183 splice site probably benign
IGL03178:Myo1g APN 11 6512181 missense probably damaging 1.00
R0004:Myo1g UTSW 11 6515901 missense probably damaging 1.00
R0334:Myo1g UTSW 11 6511084 splice site probably benign
R0513:Myo1g UTSW 11 6510203 missense probably benign 0.00
R0730:Myo1g UTSW 11 6520794 missense probably damaging 1.00
R1054:Myo1g UTSW 11 6518987 missense probably damaging 1.00
R1434:Myo1g UTSW 11 6509372 missense probably benign 0.00
R1500:Myo1g UTSW 11 6520811 missense probably benign
R1513:Myo1g UTSW 11 6515140 missense probably damaging 0.99
R1720:Myo1g UTSW 11 6512490 missense probably benign 0.44
R1774:Myo1g UTSW 11 6515988 missense probably damaging 1.00
R1809:Myo1g UTSW 11 6512283 missense probably benign 0.02
R1957:Myo1g UTSW 11 6512159 critical splice donor site probably null
R1978:Myo1g UTSW 11 6520829 missense possibly damaging 0.53
R2438:Myo1g UTSW 11 6511542 missense probably damaging 1.00
R2566:Myo1g UTSW 11 6512539 critical splice acceptor site probably null
R3158:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3159:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3413:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R3816:Myo1g UTSW 11 6510926 missense probably benign 0.02
R3872:Myo1g UTSW 11 6514886 missense possibly damaging 0.94
R3946:Myo1g UTSW 11 6520760 missense possibly damaging 0.89
R4551:Myo1g UTSW 11 6517874 missense probably damaging 1.00
R4625:Myo1g UTSW 11 6512240 missense probably damaging 1.00
R4630:Myo1g UTSW 11 6519047 missense probably damaging 1.00
R4700:Myo1g UTSW 11 6516785 unclassified probably null
R4713:Myo1g UTSW 11 6516080 missense probably null 1.00
R4964:Myo1g UTSW 11 6515976 missense probably damaging 1.00
R5183:Myo1g UTSW 11 6508243 missense probably damaging 1.00
R5191:Myo1g UTSW 11 6515105 missense probably benign
R5192:Myo1g UTSW 11 6514816 missense probably damaging 1.00
R5726:Myo1g UTSW 11 6509420 missense probably benign 0.06
R5841:Myo1g UTSW 11 6507000 missense probably benign 0.05
R5942:Myo1g UTSW 11 6514888 missense probably damaging 1.00
R6225:Myo1g UTSW 11 6519168 missense probably damaging 1.00
R6517:Myo1g UTSW 11 6512509 missense probably damaging 0.99
R6563:Myo1g UTSW 11 6517146 missense possibly damaging 0.91
R7214:Myo1g UTSW 11 6511055 missense probably damaging 1.00
R7258:Myo1g UTSW 11 6509416 missense possibly damaging 0.92
R7265:Myo1g UTSW 11 6510933 missense possibly damaging 0.92
X0017:Myo1g UTSW 11 6516077 critical splice donor site probably null
X0061:Myo1g UTSW 11 6517967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCATCATGTGTTTCCAG -3'
(R):5'- ATCCCGAGATGCTGCAGTTG -3'

Sequencing Primer
(F):5'- TCCAGGTGGAAAGTAGCCC -3'
(R):5'- ATGTTGCACTGACCCTACGG -3'
Posted On2014-10-15