Incidental Mutation 'R2212:Adarb2'
ID239470
Institutional Source Beutler Lab
Gene Symbol Adarb2
Ensembl Gene ENSMUSG00000052551
Gene Nameadenosine deaminase, RNA-specific, B2
SynonymsAdar3, RED2
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2212 (G1)
Quality Score206
Status Not validated
Chromosome13
Chromosomal Location8202866-8768747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8752618 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 643 (F643S)
Ref Sequence ENSEMBL: ENSMUSP00000120757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064473] [ENSMUST00000123187] [ENSMUST00000135574]
Predicted Effect probably damaging
Transcript: ENSMUST00000064473
AA Change: F643S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064775
Gene: ENSMUSG00000052551
AA Change: F643S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123187
AA Change: F643S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120757
Gene: ENSMUSG00000052551
AA Change: F643S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 6.1e-19 SMART
DSRM 284 346 7.3e-18 SMART
ADEAMc 366 698 2e-164 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135574
AA Change: F643S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115148
Gene: ENSMUSG00000052551
AA Change: F643S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Adarb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Adarb2 APN 13 8701725 missense probably benign 0.00
IGL00910:Adarb2 APN 13 8672433 missense probably damaging 1.00
IGL01308:Adarb2 APN 13 8203293 missense possibly damaging 0.93
IGL01337:Adarb2 APN 13 8570246 missense probably benign 0.03
IGL01508:Adarb2 APN 13 8752570 splice site probably null
IGL01792:Adarb2 APN 13 8570149 missense probably damaging 1.00
IGL02387:Adarb2 APN 13 8569958 missense probably damaging 1.00
IGL02423:Adarb2 APN 13 8569720 missense probably damaging 0.99
R0304:Adarb2 UTSW 13 8752570 splice site probably benign
R0463:Adarb2 UTSW 13 8203188 start gained probably benign
R0646:Adarb2 UTSW 13 8731819 missense probably damaging 1.00
R0963:Adarb2 UTSW 13 8672415 missense probably damaging 1.00
R1066:Adarb2 UTSW 13 8757323 missense probably benign 0.14
R1451:Adarb2 UTSW 13 8339621 intron probably benign
R1656:Adarb2 UTSW 13 8203251 missense unknown
R1939:Adarb2 UTSW 13 8203322 critical splice donor site probably null
R2484:Adarb2 UTSW 13 8569774 nonsense probably null
R2993:Adarb2 UTSW 13 8713716 missense probably benign 0.02
R3157:Adarb2 UTSW 13 8697633 missense probably benign 0.20
R3177:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3277:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3412:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R3949:Adarb2 UTSW 13 8570419 missense probably damaging 0.97
R4505:Adarb2 UTSW 13 8697691 missense probably damaging 1.00
R5232:Adarb2 UTSW 13 8713640 missense possibly damaging 0.80
R5831:Adarb2 UTSW 13 8559133 missense probably benign 0.45
R7113:Adarb2 UTSW 13 8731845 missense probably damaging 0.99
R7252:Adarb2 UTSW 13 8570180 missense probably benign 0.00
R7259:Adarb2 UTSW 13 8570252 missense probably benign
R7346:Adarb2 UTSW 13 8570384 missense probably damaging 1.00
R7422:Adarb2 UTSW 13 8757277 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TAGAACTGTGCCTTCACGCG -3'
(R):5'- TTTAACCAGAGCCCAGGTACG -3'

Sequencing Primer
(F):5'- CCTTCACGCGACTGAGTGTTAAG -3'
(R):5'- GGCTAATTTTCTCCCCAGAAAGG -3'
Posted On2014-10-15