Incidental Mutation 'R0184:Hipk2'
ID 23952
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Name homeodomain interacting protein kinase 2
Synonyms B230339E18Rik, 1110014O20Rik, Stank
MMRRC Submission 038449-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R0184 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 6
Chromosomal Location 38671325-38853099 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38695866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 726 (N726S)
Ref Sequence ENSEMBL: ENSMUSP00000125150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
AlphaFold Q9QZR5
Predicted Effect probably benign
Transcript: ENSMUST00000160360
AA Change: N725S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436
AA Change: N725S

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160962
AA Change: N718S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436
AA Change: N718S

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161779
AA Change: N753S

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436
AA Change: N753S

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162359
AA Change: N726S

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436
AA Change: N726S

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Meta Mutation Damage Score 0.1354 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,212,899 (GRCm39) V131F probably damaging Het
Adam28 T C 14: 68,874,822 (GRCm39) D285G probably benign Het
Akr1c13 A G 13: 4,244,055 (GRCm39) E36G probably damaging Het
Antxr2 A G 5: 98,127,889 (GRCm39) L214S probably damaging Het
Arhgap26 T A 18: 38,750,726 (GRCm39) D46E unknown Het
Armc9 T C 1: 86,126,092 (GRCm39) L61P probably damaging Het
Bicc1 C A 10: 70,915,045 (GRCm39) R73L probably benign Het
Calm2 T C 17: 87,743,269 (GRCm39) N43S probably benign Het
Cct7 A G 6: 85,438,536 (GRCm39) D105G probably null Het
Cdk18 T C 1: 132,046,276 (GRCm39) N215D probably benign Het
Cep126 T C 9: 8,103,396 (GRCm39) T205A probably benign Het
Cfap57 A T 4: 118,456,209 (GRCm39) I495N probably damaging Het
Cyp2b9 T A 7: 25,886,432 (GRCm39) C152* probably null Het
Dab2ip G A 2: 35,608,803 (GRCm39) R579H probably damaging Het
Dnah8 T C 17: 30,902,657 (GRCm39) V905A probably benign Het
Eif4h C A 5: 134,654,229 (GRCm39) D134Y possibly damaging Het
Espl1 T A 15: 102,207,651 (GRCm39) S372T probably benign Het
Fat2 T A 11: 55,187,114 (GRCm39) H1244L probably damaging Het
Fbxo11 T A 17: 88,316,101 (GRCm39) N443I probably benign Het
Git2 G A 5: 114,877,098 (GRCm39) T128M possibly damaging Het
Gm10985 T A 3: 53,752,679 (GRCm39) Y21N probably damaging Het
Gm12790 A T 4: 101,824,811 (GRCm39) Y152* probably null Het
Heatr5a T C 12: 51,956,752 (GRCm39) D1115G probably benign Het
Hrg T C 16: 22,772,521 (GRCm39) probably null Het
Iars1 T G 13: 49,875,688 (GRCm39) S792A probably benign Het
Igf1r A G 7: 67,875,941 (GRCm39) N1301S possibly damaging Het
Il22 A T 10: 118,041,511 (GRCm39) I75F probably damaging Het
Ilkap T C 1: 91,304,027 (GRCm39) probably benign Het
Ints13 A T 6: 146,456,542 (GRCm39) Y435N probably benign Het
Ints8 A C 4: 11,218,637 (GRCm39) S797A probably benign Het
Itgad T A 7: 127,788,403 (GRCm39) D405E probably benign Het
Itgam A T 7: 127,685,230 (GRCm39) I448F probably damaging Het
Klk1 C T 7: 43,878,173 (GRCm39) T41I possibly damaging Het
Mcrip1 T C 11: 120,435,710 (GRCm39) M1V probably null Het
Mdga1 A G 17: 30,071,416 (GRCm39) Y128H probably damaging Het
Mtor G T 4: 148,549,428 (GRCm39) R604L probably benign Het
Or52p1 T C 7: 104,267,447 (GRCm39) V187A probably damaging Het
Or5d41 A T 2: 88,055,124 (GRCm39) L84* probably null Het
Pcdhb7 T A 18: 37,476,443 (GRCm39) D526E probably benign Het
Pip4k2a T C 2: 18,893,939 (GRCm39) D139G probably damaging Het
Pkp3 A C 7: 140,668,280 (GRCm39) N536T probably benign Het
Pla2g4c T A 7: 13,090,145 (GRCm39) S524T probably benign Het
Pno1 T C 11: 17,161,127 (GRCm39) E69G probably benign Het
Pold1 C T 7: 44,191,139 (GRCm39) V231M probably benign Het
Poli A G 18: 70,655,802 (GRCm39) S248P probably damaging Het
Ppox C T 1: 171,107,126 (GRCm39) S138N probably damaging Het
Psg20 T C 7: 18,419,901 (GRCm39) E6G probably null Het
Rbmx C T X: 56,436,926 (GRCm39) probably null Het
Rln1 T A 19: 29,309,336 (GRCm39) K148* probably null Het
Rnf213 C T 11: 119,305,347 (GRCm39) T526I probably damaging Het
Rps6kc1 A T 1: 190,531,290 (GRCm39) V904E probably null Het
Sf3b2 T A 19: 5,333,700 (GRCm39) I633F probably damaging Het
Sfswap T A 5: 129,584,253 (GRCm39) I189N probably damaging Het
Smarca2 T A 19: 26,669,649 (GRCm39) Y973* probably null Het
Spink5 G A 18: 44,136,265 (GRCm39) D559N probably benign Het
Spty2d1 C T 7: 46,647,322 (GRCm39) V536I possibly damaging Het
Tbx3 T C 5: 119,813,627 (GRCm39) I221T probably damaging Het
Tcf20 T A 15: 82,736,501 (GRCm39) D1650V probably damaging Het
Thsd7b A G 1: 129,358,701 (GRCm39) K45R probably benign Het
Tirap A G 9: 35,100,490 (GRCm39) S65P probably benign Het
Trim25 C T 11: 88,890,466 (GRCm39) P51L probably damaging Het
Trim61 T C 8: 65,467,069 (GRCm39) N64S probably benign Het
Twf1 T A 15: 94,478,948 (GRCm39) probably null Het
Ubr4 A C 4: 139,172,573 (GRCm39) T1692P probably damaging Het
Usp3 A G 9: 66,469,863 (GRCm39) M86T probably damaging Het
Utrn T C 10: 12,543,362 (GRCm39) D1762G probably benign Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Vmn2r52 T C 7: 9,893,265 (GRCm39) S625G probably damaging Het
Vmn2r90 G A 17: 17,947,139 (GRCm39) W472* probably null Het
Vrk2 C A 11: 26,500,046 (GRCm39) A56S probably damaging Het
Yeats2 C T 16: 20,022,435 (GRCm39) P620S possibly damaging Het
Zbtb21 C T 16: 97,751,713 (GRCm39) D171N probably damaging Het
Zeb1 A T 18: 5,766,808 (GRCm39) I440F probably damaging Het
Zfp292 A G 4: 34,819,563 (GRCm39) I253T probably damaging Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38,796,257 (GRCm39) splice site probably benign
IGL00814:Hipk2 APN 6 38,795,484 (GRCm39) missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38,795,208 (GRCm39) missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38,795,250 (GRCm39) missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38,796,117 (GRCm39) missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38,795,330 (GRCm39) missense probably benign 0.05
IGL02028:Hipk2 APN 6 38,795,691 (GRCm39) missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38,796,069 (GRCm39) missense probably benign
IGL02135:Hipk2 APN 6 38,795,934 (GRCm39) missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38,680,436 (GRCm39) missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38,795,456 (GRCm39) missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38,675,382 (GRCm39) missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38,706,879 (GRCm39) missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38,724,937 (GRCm39) splice site probably benign
R0070:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R0070:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R0092:Hipk2 UTSW 6 38,720,164 (GRCm39) missense probably damaging 0.97
R0494:Hipk2 UTSW 6 38,706,924 (GRCm39) missense probably benign 0.03
R0617:Hipk2 UTSW 6 38,724,420 (GRCm39) missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38,675,491 (GRCm39) missense probably damaging 1.00
R1812:Hipk2 UTSW 6 38,675,098 (GRCm39) missense probably benign 0.14
R1864:Hipk2 UTSW 6 38,695,870 (GRCm39) critical splice acceptor site probably null
R1919:Hipk2 UTSW 6 38,795,919 (GRCm39) nonsense probably null
R1995:Hipk2 UTSW 6 38,692,909 (GRCm39) missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38,795,720 (GRCm39) missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38,706,850 (GRCm39) splice site probably benign
R2384:Hipk2 UTSW 6 38,795,306 (GRCm39) missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38,720,029 (GRCm39) missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38,675,491 (GRCm39) missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38,795,861 (GRCm39) missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38,676,200 (GRCm39) missense probably damaging 1.00
R4471:Hipk2 UTSW 6 38,713,857 (GRCm39) intron probably benign
R4724:Hipk2 UTSW 6 38,675,327 (GRCm39) missense probably benign 0.10
R4838:Hipk2 UTSW 6 38,795,339 (GRCm39) missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38,796,192 (GRCm39) missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38,707,816 (GRCm39) missense possibly damaging 0.82
R5044:Hipk2 UTSW 6 38,795,814 (GRCm39) missense probably benign 0.06
R5320:Hipk2 UTSW 6 38,795,212 (GRCm39) missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38,706,977 (GRCm39) missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38,714,408 (GRCm39) missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38,795,810 (GRCm39) missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38,707,802 (GRCm39) critical splice donor site probably null
R6309:Hipk2 UTSW 6 38,675,446 (GRCm39) missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38,795,808 (GRCm39) missense probably benign 0.04
R6815:Hipk2 UTSW 6 38,795,777 (GRCm39) missense probably damaging 1.00
R7104:Hipk2 UTSW 6 38,795,579 (GRCm39) missense probably damaging 0.98
R7124:Hipk2 UTSW 6 38,795,413 (GRCm39) nonsense probably null
R7238:Hipk2 UTSW 6 38,692,992 (GRCm39) missense probably benign 0.45
R7712:Hipk2 UTSW 6 38,680,569 (GRCm39) missense probably benign 0.02
R7994:Hipk2 UTSW 6 38,795,403 (GRCm39) missense possibly damaging 0.94
R8190:Hipk2 UTSW 6 38,795,728 (GRCm39) missense possibly damaging 0.88
R8388:Hipk2 UTSW 6 38,722,630 (GRCm39) missense probably damaging 1.00
R8796:Hipk2 UTSW 6 38,675,158 (GRCm39) missense probably damaging 0.99
R9041:Hipk2 UTSW 6 38,724,909 (GRCm39) nonsense probably null
R9388:Hipk2 UTSW 6 38,707,956 (GRCm39) missense probably damaging 1.00
R9480:Hipk2 UTSW 6 38,680,377 (GRCm39) missense probably benign 0.37
R9485:Hipk2 UTSW 6 38,680,445 (GRCm39) missense possibly damaging 0.94
R9562:Hipk2 UTSW 6 38,724,390 (GRCm39) missense probably damaging 0.99
R9565:Hipk2 UTSW 6 38,724,390 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGACTGGTGCTGCTTACTCTTCC -3'
(R):5'- TTACAGGTCAGAGGCTACTCATCCC -3'

Sequencing Primer
(F):5'- CCTGGAGGAGGTGGTGC -3'
(R):5'- TAGAGCTTACAGACTCTGACTCTAC -3'
Protein Function and Prediction

Homeodomain interacting protein kinase 2 (Hipk2) is a conserved serine/threonine kinase that interacts with and phosphorylates homeodomain transcription factors to regulate transcription during development and in response to DNA damage (1). Hipk2 has a conserved N-terminal kinase domain with a DYRK motif, a nuclear localization sequence, a PEST domain, and C-terminal region that contains speckle-retention signal, an autoinhibitory domain, and a ubiquitylation site (1;2).

Northern blot analysis detected ubiquitous expression of a 11.0-kb HIPK2 transcript, with strongest expression in human neuronal tissue; a 7.8-kb transcript was detected in the uterus and a 1.4-kb transcript was detected in the pancreas (3). Hipk2 is detectable in postnatal day (P) 15 mouse embryos and is strong by P17 (4).  In situ hybridization detected expression in neural retina, telencephalon, and muscle at P16.5 (4). Similar to human HIPK2, mouse Hipk2 is ubiquitously expressed in the adult, Pierantoni et al. detected highest expression in the heart, muscle and kidney by RT-PCR (4).

Hipk2tm1Hko/tm1Hko; MGI:3624127

involves: C57BL/6

Embyronic fibroblasts from null mice are slightly resistant to UV radiation (5). Also, there are more frequent instances of neural tube defects in these mice (5).

Hipk2tm1Ejh/tm1Ejh; MGI:3487301

involves: 129X1/SvJ * C57BL/6

Homozygous mice exhibit diminished locomotor activity response to amphetamine compared with wild-type mice as well as abnormal limb grasping, impaired coordination, abnormal voluntary movement, and abnormal gait (6).  There is also decreased neuron apoptosis in dopaminergic neurons at E17.5 and P0 (6). Homozygotes have decreased dopaminergic neuron number throughout life (6).

Hipk2tm1Ejh/tm1Ejh; MGI:3487301

involves: 129X1/SvJ * C57BL/6J

In this genetic background, homozygotes have more neurons in the trigeminal ganglion at E13.5 and P0 due to a reduction in apoptotic neurons (7).

Hipk2tm1Afus/tm1Afus; MGI:4429497

involves: 129X1/SvJ * C57BL/6

Homozygotes in this model have abnormal motor capabilities/coordination/movement as well as an increase in the number of mouse embryonic fibroblasts in the G0/G1 phase of the cell cycle and reduced proliferation (8). Homozygotes have decreased birth and body weight over their life (8).

References
Posted On 2013-04-16
Science Writer Anne Murray