Incidental Mutation 'R0184:Hipk2'

• ID: 23952
• Institutional Source: Beutler Lab
• Gene Symbol: Hipk2
• Ensembl Gene: ENSMUSG00000061436
• Gene Name: homeodomain interacting protein kinase 2
• Synonyms: 1110014O20Rik, Stank, B230339E18Rik
• MMRRC Submission: 038449-MU
• Accession Numbers:

  Ncbi RefSeq: NM_001136065.1, NM_010433.2; MGI: 1314872

• Essential gene?: Probably essential (E-score: 0.961)
• Stock #: R0184 (G1)
• Quality Score: 225
• Status: Validated
• Chromosome: 6
• Chromosomal Location: 38694390-38876165 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): T to C at 38718931 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Asparagine to Serine at position 726 (N726S)
• Ref Sequence: ENSEMBL: ENSMUSP00000125150
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
• AlphaFold: Q9QZR5
• Predicted Effect: probably benign; Transcript: ENSMUST00000160360; AA Change: N725S; PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
• SMART Domains: Protein: ENSMUSP00000125500; Gene: ENSMUSG00000061436; AA Change: N725S

Domain	Start	End	E-Value	Type
low complexity region	94	104	N/A	INTRINSIC
low complexity region	156	180	N/A	INTRINSIC
S_TKc	199	527	3.05e-78	SMART
low complexity region	895	909	N/A	INTRINSIC
low complexity region	963	992	N/A	INTRINSIC
low complexity region	998	1018	N/A	INTRINSIC
low complexity region	1057	1072	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000160962; AA Change: N718S; PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
• SMART Domains: Protein: ENSMUSP00000125572; Gene: ENSMUSG00000061436; AA Change: N718S

Domain	Start	End	E-Value	Type
low complexity region	87	97	N/A	INTRINSIC
low complexity region	149	173	N/A	INTRINSIC
S_TKc	192	520	3.05e-78	SMART
low complexity region	888	902	N/A	INTRINSIC
low complexity region	956	985	N/A	INTRINSIC
low complexity region	991	1011	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

• Predicted Effect: probably benign; Transcript: ENSMUST00000161779; AA Change: N753S; PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
• SMART Domains: Protein: ENSMUSP00000124133; Gene: ENSMUSG00000061436; AA Change: N753S

Domain	Start	End	E-Value	Type
low complexity region	94	104	N/A	INTRINSIC
low complexity region	156	180	N/A	INTRINSIC
S_TKc	199	527	3.05e-78	SMART
low complexity region	923	937	N/A	INTRINSIC
low complexity region	991	1020	N/A	INTRINSIC
low complexity region	1026	1046	N/A	INTRINSIC
low complexity region	1085	1100	N/A	INTRINSIC

• Predicted Effect: possibly damaging; Transcript: ENSMUST00000162359; AA Change: N726S; PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
• SMART Domains: Protein: ENSMUSP00000125150; Gene: ENSMUSG00000061436; AA Change: N726S

Domain	Start	End	E-Value	Type
low complexity region	94	104	N/A	INTRINSIC
low complexity region	156	180	N/A	INTRINSIC
S_TKc	199	527	3.05e-78	SMART
low complexity region	896	910	N/A	INTRINSIC
low complexity region	964	993	N/A	INTRINSIC
low complexity region	999	1019	N/A	INTRINSIC
low complexity region	1058	1073	N/A	INTRINSIC

• Meta Mutation Damage Score: 0.1354
• Coding Region Coverage:
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
• Validation Efficiency: 66% (50/76)
• MGI Phenotype: Strain: 3624127; 3487301; 4429497; FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] ; PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
• Allele List at MGI:

  All alleles(10) : Targeted(7) Gene trapped(3)

• Posted On: 2013-04-16
• Science Writer: Anne Murray

Predicted Primers

PCR Primer
(F):5'- GATGACTGGTGCTGCTTACTCTTCC -3'
(R):5'- TTACAGGTCAGAGGCTACTCATCCC -3'

Sequencing Primer
(F):5'- CCTGGAGGAGGTGGTGC -3'
(R):5'- TAGAGCTTACAGACTCTGACTCTAC -3'

Protein Function and Prediction

Homeodomain interacting protein kinase 2 (Hipk2) is a conserved serine/threonine kinase that interacts with and phosphorylates homeodomain transcription factors to regulate transcription during development and in response to DNA damage (1). Hipk2 has a conserved N-terminal kinase domain with a DYRK motif, a nuclear localization sequence, a PEST domain, and C-terminal region that contains speckle-retention signal, an autoinhibitory domain, and a ubiquitylation site (1;2).

Northern blot analysis detected ubiquitous expression of a 11.0-kb HIPK2 transcript, with strongest expression in human neuronal tissue; a 7.8-kb transcript was detected in the uterus and a 1.4-kb transcript was detected in the pancreas (3). Hipk2 is detectable in postnatal day (P) 15 mouse embryos and is strong by P17 (4).  In situ hybridization detected expression in neural retina, telencephalon, and muscle at P16.5 (4). Similar to human HIPK2, mouse Hipk2 is ubiquitously expressed in the adult, Pierantoni et al. detected highest expression in the heart, muscle and kidney by RT-PCR (4).

Hipk2^{tm1Hko/tm1Hko}; MGI:3624127

involves: C57BL/6

Embyronic fibroblasts from null mice are slightly resistant to UV radiation (5). Also, there are more frequent instances of neural tube defects in these mice (5).

Hipk2^{tm1Ejh/tm1Ejh}; MGI:3487301

involves: 129X1/SvJ * C57BL/6

Homozygous mice exhibit diminished locomotor activity response to amphetamine compared with wild-type mice as well as abnormal limb grasping, impaired coordination, abnormal voluntary movement, and abnormal gait (6).  There is also decreased neuron apoptosis in dopaminergic neurons at E17.5 and P0 (6). Homozygotes have decreased dopaminergic neuron number throughout life (6).

Hipk2^{tm1Ejh/tm1Ejh}; MGI:3487301

involves: 129X1/SvJ * C57BL/6J

In this genetic background, homozygotes have more neurons in the trigeminal ganglion at E13.5 and P0 due to a reduction in apoptotic neurons (7).

Hipk2^{tm1Afus/tm1Afus}; MGI:4429497

involves: 129X1/SvJ * C57BL/6

Homozygotes in this model have abnormal motor capabilities/coordination/movement as well as an increase in the number of mouse embryonic fibroblasts in the G0/G1 phase of the cell cycle and reduced proliferation (8). Homozygotes have decreased birth and body weight over their life (8).

References

  1. Rinaldo, C., Prodosmo, A., Siepi, F., and Soddu, S. (2007) HIPK2: A Multitalented Partner for Transcription Factors in DNA Damage Response and Development. Biochem Cell Biol. 85, 411-418.

  2. Hofmann, T. G., Mincheva, A., Lichter, P., Droge, W., and Schmitz, M. L. (2000) Human Homeodomain-Interacting Protein Kinase-2 (HIPK2) is a Member of the DYRK Family of Protein Kinases and Maps to Chromosome 7q32-q34. Biochimie. 82, 1123-1127.

  3. Wang, Y., Hofmann, T. G., Runkel, L., Haaf, T., Schaller, H., Debatin, K., and Hug, H. (2001) Isolation and Characterization of cDNAs for the Protein Kinase HIPK2. Biochim Biophys Acta. 1518, 168-172.

  4. Pierantoni, G. M., Bulfone, A., Pentimalli, F., Fedele, M., Iuliano, R., Santoro, M., Chiariotti, L., Ballabio, A., and Fusco, A. (2002) The Homeodomain-Interacting Protein Kinase 2 Gene is Expressed Late in Embryogenesis and Preferentially in Retina, Muscle, and Neural Tissues. Biochem Biophys Res Commun. 290, 942-947.

  5. Isono, K., Nemoto, K., Li, Y., Takada, Y., Suzuki, R., Katsuki, M., Nakagawara, A., and Koseki, H. (2006) Overlapping Roles for Homeodomain-Interacting Protein Kinases hipk1 and hipk2 in the Mediation of Cell Growth in Response to Morphogenetic and Genotoxic Signals. Mol Cell Biol. 26, 2758-2771.

  6. Zhang, J., Pho, V., Bonasera, S. J., Holtzman, J., Tang, A. T., Hellmuth, J., Tang, S., Janak, P. H., Tecott, L. H., and Huang, E. J. (2007) Essential Function of HIPK2 in TGFbeta-Dependent Survival of Midbrain Dopamine Neurons. Nat Neurosci. 10, 77-86.

  7. Wiggins, A. K., Wei, G., Doxakis, E., Wong, C., Tang, A. A., Zang, K., Luo, E. J., Neve, R. L., Reichardt, L. F., and Huang, E. J. (2004) Interaction of Brn3a and HIPK2 Mediates Transcriptional Repression of Sensory Neuron Survival. J Cell Biol. 167, 257-267.

  8. Trapasso, F., Aqeilan, R. I., Iuliano, R., Visone, R., Gaudio, E., Ciuffini, L., Alder, H., Paduano, F., Pierantoni, G. M., Soddu, S., Croce, C. M., and Fusco, A. (2009) Targeted Disruption of the Murine Homeodomain-Interacting Protein Kinase-2 Causes Growth Deficiency in Vivo and Cell Cycle Arrest in Vitro. DNA Cell Biol. 28, 161-167.