Incidental Mutation 'R2213:Ces1a'
ID239524
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Namecarboxylesterase 1A
SynonymsGm4976
MMRRC Submission 040215-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2213 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93020214-93048192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93025225 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 427 (P427Q)
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
Predicted Effect probably damaging
Transcript: ENSMUST00000095211
AA Change: P427Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047
AA Change: P427Q

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210764
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T C 13: 4,276,248 D78G probably damaging Het
Anxa1 C T 19: 20,382,875 R124H probably damaging Het
Arhgef4 G A 1: 34,807,149 probably null Het
C87436 G A 6: 86,445,473 V10I probably benign Het
Cpm T C 10: 117,659,839 Y78H probably damaging Het
Csmd3 G A 15: 47,820,447 T1663I possibly damaging Het
Cul7 T C 17: 46,651,472 F10L probably damaging Het
Cyp2j5 T C 4: 96,659,615 N130S probably benign Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddb1 T C 19: 10,608,327 L135P probably damaging Het
Dixdc1 A G 9: 50,701,945 S211P probably benign Het
Dnah12 G T 14: 26,739,330 K970N probably benign Het
Eps15 A G 4: 109,361,220 K391E probably damaging Het
Fabp9 A G 3: 10,194,800 V51A probably damaging Het
Flg T C 3: 93,293,028 probably benign Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscb A T 12: 64,474,116 I192N possibly damaging Het
Galntl5 A G 5: 25,217,529 I333V probably benign Het
Gcnt3 A T 9: 70,034,707 V193E probably benign Het
Gle1 T C 2: 29,949,301 F535S probably damaging Het
Gm21671 G T 5: 25,953,177 T59K probably benign Het
Gpr87 A T 3: 59,179,044 S347T probably damaging Het
Gstm2 C T 3: 107,986,093 R18H probably damaging Het
H1fnt T A 15: 98,256,338 Q310L unknown Het
Haus6 C T 4: 86,581,992 E927K possibly damaging Het
Hunk A G 16: 90,432,617 N122S probably damaging Het
Itih4 T A 14: 30,890,713 V232E probably damaging Het
Jag1 G T 2: 137,089,892 D586E probably benign Het
Klk1b1 T C 7: 43,970,481 S155P probably damaging Het
Lama1 G T 17: 67,777,034 G1424* probably null Het
Lrp1 T A 10: 127,540,702 N4279I probably damaging Het
Lrrc43 G A 5: 123,503,577 V525I possibly damaging Het
Lrrc4c G A 2: 97,630,471 V481M probably benign Het
Mecr T A 4: 131,853,815 probably null Het
Megf10 T A 18: 57,288,009 Y906* probably null Het
Mpdz A G 4: 81,310,172 F1319L probably damaging Het
Mtf2 A G 5: 108,100,914 E364G possibly damaging Het
Nelfe T A 17: 34,853,883 D160E probably benign Het
Nin A G 12: 70,045,354 L727P probably damaging Het
Npat A G 9: 53,552,381 T155A probably benign Het
Nupl1 T C 14: 60,239,496 D242G probably benign Het
Olfr1251 A T 2: 89,667,547 L113Q probably damaging Het
Pnlip T C 19: 58,673,770 V116A probably benign Het
Prl7a2 T A 13: 27,665,068 L79F probably benign Het
Rbm25 A T 12: 83,676,082 I760L probably benign Het
Rbms3 A T 9: 116,959,466 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps10 C A 17: 27,630,499 probably benign Het
Slc35e4 T C 11: 3,913,159 E10G possibly damaging Het
Smad2 A T 18: 76,304,626 T434S probably damaging Het
Sox30 C T 11: 45,984,852 S477F probably damaging Het
Stat4 A T 1: 52,013,855 D65V probably damaging Het
Strip2 A G 6: 29,931,148 D366G probably damaging Het
Syngap1 C A 17: 26,953,069 R84S probably damaging Het
Synpo2l A G 14: 20,660,666 Y629H probably damaging Het
Taf4 A T 2: 179,935,890 probably null Het
Ttc21a A G 9: 119,940,461 H68R probably benign Het
Txndc8 T A 4: 57,984,199 Q144L probably benign Het
Tyr T G 7: 87,492,878 Q158P probably damaging Het
Uchl3 T A 14: 101,666,670 probably null Het
Vwa5b1 T C 4: 138,604,812 K298R probably benign Het
Wrn T C 8: 33,257,015 N891S probably benign Het
Ylpm1 A G 12: 85,069,718 S2125G probably benign Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93020467 missense probably damaging 1.00
IGL00556:Ces1a APN 8 93045059 missense probably benign 0.03
IGL00841:Ces1a APN 8 93039536 nonsense probably null
IGL01510:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01511:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01518:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01519:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01520:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01526:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01527:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01828:Ces1a APN 8 93025201 missense probably damaging 0.96
IGL01934:Ces1a APN 8 93032650 missense probably damaging 0.99
IGL02456:Ces1a APN 8 93039498 missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93036040 missense probably damaging 1.00
IGL02982:Ces1a APN 8 93044975 missense probably damaging 1.00
IGL03178:Ces1a APN 8 93020889 missense probably damaging 1.00
IGL03377:Ces1a APN 8 93039488 missense probably damaging 1.00
R0556:Ces1a UTSW 8 93045112 missense probably benign 0.01
R0613:Ces1a UTSW 8 93025581 missense probably benign 0.11
R0627:Ces1a UTSW 8 93042043 missense probably benign 0.03
R0686:Ces1a UTSW 8 93022449 missense probably damaging 1.00
R0724:Ces1a UTSW 8 93039513 missense probably damaging 0.98
R0930:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1063:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1215:Ces1a UTSW 8 93032690 missense probably damaging 1.00
R1381:Ces1a UTSW 8 93034031 missense probably damaging 0.98
R1417:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1850:Ces1a UTSW 8 93027326 missense probably damaging 1.00
R2072:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2074:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2075:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2114:Ces1a UTSW 8 93039551 missense possibly damaging 0.93
R2346:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2347:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2483:Ces1a UTSW 8 93027341 missense probably damaging 1.00
R4515:Ces1a UTSW 8 93020904 missense probably damaging 1.00
R4587:Ces1a UTSW 8 93025304 missense probably damaging 1.00
R4691:Ces1a UTSW 8 93032659 missense probably benign 0.00
R4992:Ces1a UTSW 8 93045022 missense probably benign 0.08
R5074:Ces1a UTSW 8 93032675 missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93027353 missense probably benign 0.03
R7390:Ces1a UTSW 8 93044841 intron probably null
Z1088:Ces1a UTSW 8 93025607 missense probably benign 0.02
Z1176:Ces1a UTSW 8 93036085 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TCTTGTTTACAGGCAGGTTAGC -3'
(R):5'- CTGGAAAACATACGTTGCTCATTG -3'

Sequencing Primer
(F):5'- TACAGATAGCCATGCCCATGTGTG -3'
(R):5'- CTCATTGCATGGGGGTGGAC -3'
Posted On2014-10-15