Incidental Mutation 'R2213:Megf10'
ID 239561
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms 3000002B06Rik, LOC240312
MMRRC Submission 040215-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R2213 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 57133090-57297467 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 57288009 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 906 (Y906*)
Ref Sequence ENSEMBL: ENSMUSP00000116814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably null
Transcript: ENSMUST00000075770
AA Change: Y906*
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: Y906*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139892
AA Change: Y906*
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: Y906*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1c12 T C 13: 4,276,248 D78G probably damaging Het
Anxa1 C T 19: 20,382,875 R124H probably damaging Het
Arhgef4 G A 1: 34,807,149 probably null Het
C87436 G A 6: 86,445,473 V10I probably benign Het
Ces1a G T 8: 93,025,225 P427Q probably damaging Het
Cpm T C 10: 117,659,839 Y78H probably damaging Het
Csmd3 G A 15: 47,820,447 T1663I possibly damaging Het
Cul7 T C 17: 46,651,472 F10L probably damaging Het
Cyp2j5 T C 4: 96,659,615 N130S probably benign Het
Dclk1 G A 3: 55,480,433 C100Y probably damaging Het
Ddb1 T C 19: 10,608,327 L135P probably damaging Het
Dixdc1 A G 9: 50,701,945 S211P probably benign Het
Dnah12 G T 14: 26,739,330 K970N probably benign Het
Eps15 A G 4: 109,361,220 K391E probably damaging Het
Fabp9 A G 3: 10,194,800 V51A probably damaging Het
Flg T C 3: 93,293,028 probably benign Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscb A T 12: 64,474,116 I192N possibly damaging Het
Galntl5 A G 5: 25,217,529 I333V probably benign Het
Gcnt3 A T 9: 70,034,707 V193E probably benign Het
Gle1 T C 2: 29,949,301 F535S probably damaging Het
Gm21671 G T 5: 25,953,177 T59K probably benign Het
Gpr87 A T 3: 59,179,044 S347T probably damaging Het
Gstm2 C T 3: 107,986,093 R18H probably damaging Het
H1fnt T A 15: 98,256,338 Q310L unknown Het
Haus6 C T 4: 86,581,992 E927K possibly damaging Het
Hunk A G 16: 90,432,617 N122S probably damaging Het
Itih4 T A 14: 30,890,713 V232E probably damaging Het
Jag1 G T 2: 137,089,892 D586E probably benign Het
Klk1b1 T C 7: 43,970,481 S155P probably damaging Het
Lama1 G T 17: 67,777,034 G1424* probably null Het
Lrp1 T A 10: 127,540,702 N4279I probably damaging Het
Lrrc43 G A 5: 123,503,577 V525I possibly damaging Het
Lrrc4c G A 2: 97,630,471 V481M probably benign Het
Mecr T A 4: 131,853,815 probably null Het
Mpdz A G 4: 81,310,172 F1319L probably damaging Het
Mtf2 A G 5: 108,100,914 E364G possibly damaging Het
Nelfe T A 17: 34,853,883 D160E probably benign Het
Nin A G 12: 70,045,354 L727P probably damaging Het
Npat A G 9: 53,552,381 T155A probably benign Het
Nupl1 T C 14: 60,239,496 D242G probably benign Het
Olfr1251 A T 2: 89,667,547 L113Q probably damaging Het
Pnlip T C 19: 58,673,770 V116A probably benign Het
Prl7a2 T A 13: 27,665,068 L79F probably benign Het
Rbm25 A T 12: 83,676,082 I760L probably benign Het
Rbms3 A T 9: 116,959,466 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps10 C A 17: 27,630,499 probably benign Het
Slc35e4 T C 11: 3,913,159 E10G possibly damaging Het
Smad2 A T 18: 76,304,626 T434S probably damaging Het
Sox30 C T 11: 45,984,852 S477F probably damaging Het
Stat4 A T 1: 52,013,855 D65V probably damaging Het
Strip2 A G 6: 29,931,148 D366G probably damaging Het
Syngap1 C A 17: 26,953,069 R84S probably damaging Het
Synpo2l A G 14: 20,660,666 Y629H probably damaging Het
Taf4 A T 2: 179,935,890 probably null Het
Ttc21a A G 9: 119,940,461 H68R probably benign Het
Txndc8 T A 4: 57,984,199 Q144L probably benign Het
Tyr T G 7: 87,492,878 Q158P probably damaging Het
Uchl3 T A 14: 101,666,670 probably null Het
Vwa5b1 T C 4: 138,604,812 K298R probably benign Het
Wrn T C 8: 33,257,015 N891S probably benign Het
Ylpm1 A G 12: 85,069,718 S2125G probably benign Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
deep UTSW 18 57262131 missense probably damaging 1.00
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
R8527:Megf10 UTSW 18 57292718 missense probably benign 0.00
R8559:Megf10 UTSW 18 57240627 missense probably damaging 1.00
R9117:Megf10 UTSW 18 57259701 missense probably damaging 1.00
R9337:Megf10 UTSW 18 57261180 nonsense probably null
R9481:Megf10 UTSW 18 57262018 missense probably benign 0.38
R9644:Megf10 UTSW 18 57242701 missense probably benign
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGGTTATCATCGTGGGCAATC -3'
(R):5'- CTGCTAAGATATAAACCAACTCTCG -3'

Sequencing Primer
(F):5'- TCATCGTGGGCAATCTGAAC -3'
(R):5'- GAAGCACATAAACCTCTTCAGAAGG -3'
Posted On 2014-10-15