Incidental Mutation 'R2229:Rgsl1'
ID239568
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153822358 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 482 (W482L)
Ref Sequence ENSEMBL: ENSMUSP00000135642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124558
AA Change: W482L

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: W482L

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134030
Predicted Effect unknown
Transcript: ENSMUST00000184095
AA Change: W15L
Predicted Effect probably benign
Transcript: ENSMUST00000185164
AA Change: W517L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: W517L

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Meta Mutation Damage Score 0.0849 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2008:Rgsl1 UTSW 1 153825905 missense possibly damaging 0.53
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- AGAGCACCAAGGATTGTGTC -3'
(R):5'- CAAGCGCTCTGAGTTACTTTG -3'

Sequencing Primer
(F):5'- GGATTGTGTCCAGCTCCTGC -3'
(R):5'- CCATTTTCTGATGCTTATAGAGGGGC -3'
Posted On2014-10-15