Incidental Mutation 'R0184:Pla2g4c'
ID 23958
Institutional Source Beutler Lab
Gene Symbol Pla2g4c
Ensembl Gene ENSMUSG00000033847
Gene Name phospholipase A2, group IVC (cytosolic, calcium-independent)
Synonyms CPLA2-gamma
MMRRC Submission 038449-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R0184 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 13058580-13094597 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13090145 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 524 (S524T)
Ref Sequence ENSEMBL: ENSMUSP00000043672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043612] [ENSMUST00000108528] [ENSMUST00000167232]
AlphaFold Q64GA5
Predicted Effect probably benign
Transcript: ENSMUST00000043612
AA Change: S524T

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043672
Gene: ENSMUSG00000033847
AA Change: S524T

DomainStartEndE-ValueType
PLAc 1 534 1.97e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108528
AA Change: S534T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104168
Gene: ENSMUSG00000033847
AA Change: S534T

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167232
AA Change: S534T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127060
Gene: ENSMUSG00000033847
AA Change: S534T

DomainStartEndE-ValueType
PLAc 1 544 1.23e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204668
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the phospholipase A2 enzyme family which hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids, both of which serve as precursors in the production of signaling molecules. The encoded protein has been shown to be a calcium-independent and membrane bound enzyme. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,212,899 (GRCm39) V131F probably damaging Het
Adam28 T C 14: 68,874,822 (GRCm39) D285G probably benign Het
Akr1c13 A G 13: 4,244,055 (GRCm39) E36G probably damaging Het
Antxr2 A G 5: 98,127,889 (GRCm39) L214S probably damaging Het
Arhgap26 T A 18: 38,750,726 (GRCm39) D46E unknown Het
Armc9 T C 1: 86,126,092 (GRCm39) L61P probably damaging Het
Bicc1 C A 10: 70,915,045 (GRCm39) R73L probably benign Het
Calm2 T C 17: 87,743,269 (GRCm39) N43S probably benign Het
Cct7 A G 6: 85,438,536 (GRCm39) D105G probably null Het
Cdk18 T C 1: 132,046,276 (GRCm39) N215D probably benign Het
Cep126 T C 9: 8,103,396 (GRCm39) T205A probably benign Het
Cfap57 A T 4: 118,456,209 (GRCm39) I495N probably damaging Het
Cyp2b9 T A 7: 25,886,432 (GRCm39) C152* probably null Het
Dab2ip G A 2: 35,608,803 (GRCm39) R579H probably damaging Het
Dnah8 T C 17: 30,902,657 (GRCm39) V905A probably benign Het
Eif4h C A 5: 134,654,229 (GRCm39) D134Y possibly damaging Het
Espl1 T A 15: 102,207,651 (GRCm39) S372T probably benign Het
Fat2 T A 11: 55,187,114 (GRCm39) H1244L probably damaging Het
Fbxo11 T A 17: 88,316,101 (GRCm39) N443I probably benign Het
Git2 G A 5: 114,877,098 (GRCm39) T128M possibly damaging Het
Gm10985 T A 3: 53,752,679 (GRCm39) Y21N probably damaging Het
Gm12790 A T 4: 101,824,811 (GRCm39) Y152* probably null Het
Heatr5a T C 12: 51,956,752 (GRCm39) D1115G probably benign Het
Hipk2 T C 6: 38,695,866 (GRCm39) N726S possibly damaging Het
Hrg T C 16: 22,772,521 (GRCm39) probably null Het
Iars1 T G 13: 49,875,688 (GRCm39) S792A probably benign Het
Igf1r A G 7: 67,875,941 (GRCm39) N1301S possibly damaging Het
Il22 A T 10: 118,041,511 (GRCm39) I75F probably damaging Het
Ilkap T C 1: 91,304,027 (GRCm39) probably benign Het
Ints13 A T 6: 146,456,542 (GRCm39) Y435N probably benign Het
Ints8 A C 4: 11,218,637 (GRCm39) S797A probably benign Het
Itgad T A 7: 127,788,403 (GRCm39) D405E probably benign Het
Itgam A T 7: 127,685,230 (GRCm39) I448F probably damaging Het
Klk1 C T 7: 43,878,173 (GRCm39) T41I possibly damaging Het
Mcrip1 T C 11: 120,435,710 (GRCm39) M1V probably null Het
Mdga1 A G 17: 30,071,416 (GRCm39) Y128H probably damaging Het
Mtor G T 4: 148,549,428 (GRCm39) R604L probably benign Het
Or52p1 T C 7: 104,267,447 (GRCm39) V187A probably damaging Het
Or5d41 A T 2: 88,055,124 (GRCm39) L84* probably null Het
Pcdhb7 T A 18: 37,476,443 (GRCm39) D526E probably benign Het
Pip4k2a T C 2: 18,893,939 (GRCm39) D139G probably damaging Het
Pkp3 A C 7: 140,668,280 (GRCm39) N536T probably benign Het
Pno1 T C 11: 17,161,127 (GRCm39) E69G probably benign Het
Pold1 C T 7: 44,191,139 (GRCm39) V231M probably benign Het
Poli A G 18: 70,655,802 (GRCm39) S248P probably damaging Het
Ppox C T 1: 171,107,126 (GRCm39) S138N probably damaging Het
Psg20 T C 7: 18,419,901 (GRCm39) E6G probably null Het
Rbmx C T X: 56,436,926 (GRCm39) probably null Het
Rln1 T A 19: 29,309,336 (GRCm39) K148* probably null Het
Rnf213 C T 11: 119,305,347 (GRCm39) T526I probably damaging Het
Rps6kc1 A T 1: 190,531,290 (GRCm39) V904E probably null Het
Sf3b2 T A 19: 5,333,700 (GRCm39) I633F probably damaging Het
Sfswap T A 5: 129,584,253 (GRCm39) I189N probably damaging Het
Smarca2 T A 19: 26,669,649 (GRCm39) Y973* probably null Het
Spink5 G A 18: 44,136,265 (GRCm39) D559N probably benign Het
Spty2d1 C T 7: 46,647,322 (GRCm39) V536I possibly damaging Het
Tbx3 T C 5: 119,813,627 (GRCm39) I221T probably damaging Het
Tcf20 T A 15: 82,736,501 (GRCm39) D1650V probably damaging Het
Thsd7b A G 1: 129,358,701 (GRCm39) K45R probably benign Het
Tirap A G 9: 35,100,490 (GRCm39) S65P probably benign Het
Trim25 C T 11: 88,890,466 (GRCm39) P51L probably damaging Het
Trim61 T C 8: 65,467,069 (GRCm39) N64S probably benign Het
Twf1 T A 15: 94,478,948 (GRCm39) probably null Het
Ubr4 A C 4: 139,172,573 (GRCm39) T1692P probably damaging Het
Usp3 A G 9: 66,469,863 (GRCm39) M86T probably damaging Het
Utrn T C 10: 12,543,362 (GRCm39) D1762G probably benign Het
V1rd19 T A 7: 23,702,632 (GRCm39) F33I probably benign Het
Vmn2r52 T C 7: 9,893,265 (GRCm39) S625G probably damaging Het
Vmn2r90 G A 17: 17,947,139 (GRCm39) W472* probably null Het
Vrk2 C A 11: 26,500,046 (GRCm39) A56S probably damaging Het
Yeats2 C T 16: 20,022,435 (GRCm39) P620S possibly damaging Het
Zbtb21 C T 16: 97,751,713 (GRCm39) D171N probably damaging Het
Zeb1 A T 18: 5,766,808 (GRCm39) I440F probably damaging Het
Zfp292 A G 4: 34,819,563 (GRCm39) I253T probably damaging Het
Other mutations in Pla2g4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Pla2g4c APN 7 13,077,951 (GRCm39) missense probably benign 0.01
IGL00972:Pla2g4c APN 7 13,074,583 (GRCm39) missense probably benign 0.13
IGL01759:Pla2g4c APN 7 13,082,241 (GRCm39) missense probably damaging 1.00
IGL02567:Pla2g4c APN 7 13,079,965 (GRCm39) missense probably damaging 1.00
IGL02629:Pla2g4c APN 7 13,069,302 (GRCm39) nonsense probably null
IGL02719:Pla2g4c APN 7 13,064,019 (GRCm39) missense probably damaging 1.00
IGL02812:Pla2g4c APN 7 13,082,290 (GRCm39) missense probably damaging 1.00
PIT4142001:Pla2g4c UTSW 7 13,077,316 (GRCm39) missense probably benign
R1052:Pla2g4c UTSW 7 13,077,334 (GRCm39) missense possibly damaging 0.95
R1747:Pla2g4c UTSW 7 13,071,655 (GRCm39) splice site probably benign
R4381:Pla2g4c UTSW 7 13,079,990 (GRCm39) missense probably damaging 1.00
R4486:Pla2g4c UTSW 7 13,071,676 (GRCm39) missense probably benign 0.09
R4674:Pla2g4c UTSW 7 13,077,439 (GRCm39) missense probably null 0.24
R4811:Pla2g4c UTSW 7 13,071,738 (GRCm39) missense probably damaging 1.00
R5655:Pla2g4c UTSW 7 13,063,889 (GRCm39) splice site probably null
R5791:Pla2g4c UTSW 7 13,073,617 (GRCm39) missense probably benign 0.32
R5814:Pla2g4c UTSW 7 13,074,543 (GRCm39) missense probably damaging 1.00
R6381:Pla2g4c UTSW 7 13,077,933 (GRCm39) missense probably benign 0.05
R6395:Pla2g4c UTSW 7 13,077,933 (GRCm39) missense probably benign 0.05
R6974:Pla2g4c UTSW 7 13,078,459 (GRCm39) critical splice donor site probably null
R7257:Pla2g4c UTSW 7 13,059,669 (GRCm39) missense possibly damaging 0.46
R7823:Pla2g4c UTSW 7 13,063,944 (GRCm39) missense probably damaging 1.00
R8385:Pla2g4c UTSW 7 13,063,589 (GRCm39) missense probably benign 0.00
R8737:Pla2g4c UTSW 7 13,069,154 (GRCm39) missense probably benign 0.15
R8933:Pla2g4c UTSW 7 13,073,627 (GRCm39) missense probably benign 0.25
R9086:Pla2g4c UTSW 7 13,071,692 (GRCm39) missense probably benign 0.13
R9121:Pla2g4c UTSW 7 13,091,010 (GRCm39) missense probably damaging 0.99
R9226:Pla2g4c UTSW 7 13,059,671 (GRCm39) missense possibly damaging 0.83
R9456:Pla2g4c UTSW 7 13,077,900 (GRCm39) missense probably damaging 1.00
Z1088:Pla2g4c UTSW 7 13,063,678 (GRCm39) missense probably benign 0.13
Z1177:Pla2g4c UTSW 7 13,082,252 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCTCCAGATAATACAGGTTAATGTGGAAAAG -3'
(R):5'- TGGGCAGTCTCAACATCCATAGCAA -3'

Sequencing Primer
(F):5'- TTCCTAAAGAAGTGTAAAACAGTACC -3'
(R):5'- ccacacccctaatcactcac -3'
Posted On 2013-04-16