Mutagenetix > Incidental Mutation

Incidental Mutation 'R2229:Hist2h2ab'

239582

Institutional Source

Beutler Lab

Gene Symbol

Hist2h2ab

Ensembl Gene

ENSMUSG00000063689

Gene Name

histone cluster 2, H2ab

Synonyms

H2a-613a, EG621893

MMRRC Submission

040230-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R2229 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96219865-96220308 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96220106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 64 (L64P)

Ref Sequence

ENSEMBL: ENSMUSP00000072858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073115] [ENSMUST00000090781] [ENSMUST00000090782] [ENSMUST00000177442]

AlphaFold

Q64522

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073115
AA Change: L64P

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000072858
Gene: ENSMUSG00000063689
AA Change: L64P

Domain	Start	End	E-Value	Type
H2A	3	123	8.91e-83	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090781

SMART Domains

Protein: ENSMUSP00000088287
Gene: ENSMUSG00000068854

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
H2B	28	124	1.14e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090782

SMART Domains

Protein: ENSMUSP00000088288
Gene: ENSMUSG00000068855

Domain	Start	End	E-Value	Type
H2A	3	123	1.1e-82	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148335

Predicted Effect

probably benign
Transcript: ENSMUST00000177442

SMART Domains

Protein: ENSMUSP00000134765
Gene: ENSMUSG00000015943

Domain	Start	End	E-Value	Type
low complexity region	20	35	N/A	INTRINSIC
Pfam:BolA	40	113	7.8e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197012

Meta Mutation Damage Score

0.9039

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam24	A	T	8: 40,680,365	I291L	probably benign	Het
Adcy8	C	A	15: 64,822,207	R407L	possibly damaging	Het
Adgb	A	T	10: 10,436,051	V212E	probably damaging	Het
Adgrg7	C	T	16: 56,752,403	S350N	probably benign	Het
Agbl1	A	G	7: 76,433,378	T448A	probably benign	Het
Aldh1l1	C	G	6: 90,583,186	T605R	probably damaging	Het
Arfip1	A	T	3: 84,547,973	N18K	probably damaging	Het
Atp6v1b2	C	A	8: 69,102,759		probably null	Het
Banp	G	A	8: 121,978,685	S98N	probably damaging	Het
Btnl9	T	C	11: 49,169,118	D601G	probably damaging	Het
C9	T	C	15: 6,445,420	I20T	possibly damaging	Het
Cacna1b	A	G	2: 24,685,804	V744A	probably damaging	Het
Catsper3	A	G	13: 55,808,054	E311G	probably damaging	Het
Ccdc180	G	T	4: 45,948,856		probably null	Het
Cdc5l	A	G	17: 45,407,846	Y615H	probably benign	Het
Crybg2	TGGAGGAGGAGGAGGAGGAG	TGGAGGAGGAGGAGGAG	4: 134,074,526		probably benign	Het
Eml4	C	T	17: 83,451,056	P502S	probably benign	Het
Fsip1	T	C	2: 118,222,444	E367G	probably benign	Het
Gja3	T	C	14: 57,036,714	D67G	probably damaging	Het
Gm4894	T	C	9: 49,274,190		probably benign	Het
Gm7853	A	G	14: 36,089,527		noncoding transcript	Het
Gmps	T	G	3: 64,014,263	Y562*	probably null	Het
Golga2	C	A	2: 32,306,465	P976T	probably benign	Het
Gpr182	T	A	10: 127,750,141	I314F	possibly damaging	Het
Gprc6a	A	G	10: 51,626,795	V324A	possibly damaging	Het
Gykl1	A	G	18: 52,695,267	T516A	probably benign	Het
Ifit1bl2	G	T	19: 34,619,230	L329M	possibly damaging	Het
Igsf9b	T	C	9: 27,333,496	S920P	probably damaging	Het
Kif3c	T	A	12: 3,366,671	S231T	probably benign	Het
Kpna7	A	T	5: 144,989,697	Y482N	probably damaging	Het
Lmnb2	T	C	10: 80,904,392		probably benign	Het
Lrrc69	T	C	4: 14,773,694	S121G	probably benign	Het
Mppe1	A	G	18: 67,228,011		probably null	Het
Muc5b	T	A	7: 141,861,644	C2776S	possibly damaging	Het
Myh8	T	G	11: 67,308,348	N1893K	probably damaging	Het
Myo7a	T	C	7: 98,054,910	T1932A	probably benign	Het
Nbn	A	G	4: 15,970,904	T296A	probably benign	Het
Nckap1l	T	C	15: 103,455,934		probably null	Het
Nek5	A	T	8: 22,113,632	N151K	possibly damaging	Het
Nup93	C	T	8: 94,304,191	T305I	probably benign	Het
Oca2	T	A	7: 56,357,155	H663Q	probably benign	Het
Optn	T	A	2: 5,024,117	H525L	probably damaging	Het
Pdzph1	A	G	17: 58,932,412		probably benign	Het
Pikfyve	A	G	1: 65,267,855	K1801E	probably damaging	Het
Pkd2l2	G	A	18: 34,430,329	V478M	probably damaging	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Ppp1r3c	C	A	19: 36,733,698	R224L	probably benign	Het
Prpf19	A	G	19: 10,897,598	T39A	probably benign	Het
Pwwp2b	T	C	7: 139,255,188	C182R	probably damaging	Het
Rcan3	T	C	4: 135,425,377	D11G	probably benign	Het
Rgsl1	C	A	1: 153,822,358	W482L	possibly damaging	Het
Sfxn4	C	T	19: 60,851,020	G200E	probably damaging	Het
Slc4a8	T	C	15: 100,809,299	I848T	probably damaging	Het
Slc7a13	T	C	4: 19,839,399	V334A	probably benign	Het
Smarcc2	A	G	10: 128,488,341		probably benign	Het
Spata18	A	T	5: 73,666,901	I156L	possibly damaging	Het
Spats2	T	C	15: 99,174,453		probably null	Het
Tas2r104	G	A	6: 131,685,132	H205Y	probably damaging	Het
Tcof1	A	G	18: 60,832,177		probably benign	Het
Tex15	C	A	8: 33,571,237	H232N	probably benign	Het
Tg	A	T	15: 66,674,011	Q194L	probably damaging	Het
Tnfrsf22	C	T	7: 143,644,776		probably null	Het
Trim25	T	A	11: 89,016,621	V602E	probably damaging	Het
Ttll9	A	G	2: 152,983,063	E54G	probably damaging	Het
Ttn	T	C	2: 76,729,324	T29578A	probably damaging	Het
Tubgcp5	A	G	7: 55,830,881	Q960R	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp13	A	G	3: 32,917,551	I727V	probably benign	Het
Vmn2r67	T	A	7: 85,152,042	I229F	probably benign	Het
Vmn2r92	A	C	17: 18,167,392	I220L	probably benign	Het
Wnk4	T	A	11: 101,275,641		probably benign	Het
Wwp1	A	T	4: 19,641,745	Y437N	probably damaging	Het
Zdhhc5	A	G	2: 84,690,213	I540T	probably damaging	Het
Zfp729b	T	C	13: 67,595,265	I60M	probably damaging	Het

Other mutations in Hist2h2ab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0837:Hist2h2ab	UTSW	3	96220123	missense	probably damaging	1.00
R5578:Hist2h2ab	UTSW	3	96220238	missense	probably damaging	1.00
R5635:Hist2h2ab	UTSW	3	96220277	missense	possibly damaging	0.52
R7034:Hist2h2ab	UTSW	3	96219988	nonsense	probably null
R9495:Hist2h2ab	UTSW	3	96220085	missense	probably damaging	1.00
R9514:Hist2h2ab	UTSW	3	96220085	missense	probably damaging	1.00
Z1176:Hist2h2ab	UTSW	3	96220051	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- AGAAATTGCTTATTCCGCCATG -3'
(R):5'- TCCAGGCTTATGACTTTCCG -3'

Sequencing Primer
(F):5'- TCTGGCCGTGGCAAACAAG -3'
(R):5'- CGTTTTCTTCGGAAGTAAGACAGCC -3'

Posted On

2014-10-15