Incidental Mutation 'R2229:Lrrc69'
ID239583
Institutional Source Beutler Lab
Gene Symbol Lrrc69
Ensembl Gene ENSMUSG00000023151
Gene Nameleucine rich repeat containing 69
Synonyms
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location14623620-14796060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14773694 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 121 (S121G)
Ref Sequence ENSEMBL: ENSMUSP00000103911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023917] [ENSMUST00000108276]
Predicted Effect probably benign
Transcript: ENSMUST00000023917
AA Change: S121G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023917
Gene: ENSMUSG00000023151
AA Change: S121G

DomainStartEndE-ValueType
LRR 36 58 4.57e0 SMART
LRR 59 81 2.82e0 SMART
LRR 82 105 7.55e-1 SMART
LRR 106 128 7.79e0 SMART
LRR 129 151 1.99e0 SMART
LRR 152 174 5.72e0 SMART
LRR 175 197 3.86e0 SMART
LRR 198 220 8.24e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108276
AA Change: S121G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103911
Gene: ENSMUSG00000023151
AA Change: S121G

DomainStartEndE-ValueType
LRR 36 58 4.57e0 SMART
LRR 59 81 2.82e0 SMART
LRR 82 105 7.55e-1 SMART
LRR 106 128 7.79e0 SMART
LRR 129 151 1.99e0 SMART
LRR 152 174 5.72e0 SMART
LRR 175 197 3.86e0 SMART
LRR 198 220 8.24e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Lrrc69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Lrrc69 APN 4 14773663 splice site probably benign
IGL01886:Lrrc69 APN 4 14703984 missense probably benign 0.01
IGL03084:Lrrc69 APN 4 14708631 missense probably damaging 1.00
R0588:Lrrc69 UTSW 4 14704001 missense possibly damaging 0.71
R1664:Lrrc69 UTSW 4 14775079 missense probably damaging 1.00
R1956:Lrrc69 UTSW 4 14665986 missense possibly damaging 0.50
R1984:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R1985:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R1986:Lrrc69 UTSW 4 14708669 missense possibly damaging 0.93
R3691:Lrrc69 UTSW 4 14795980 missense possibly damaging 0.94
R5691:Lrrc69 UTSW 4 14769648 missense probably damaging 1.00
R5882:Lrrc69 UTSW 4 14708690 missense probably damaging 1.00
R6113:Lrrc69 UTSW 4 14708673 missense probably benign 0.00
R7228:Lrrc69 UTSW 4 14775027 missense probably damaging 1.00
R7880:Lrrc69 UTSW 4 14703946 missense possibly damaging 0.90
R8047:Lrrc69 UTSW 4 14773726 missense probably benign 0.07
R8375:Lrrc69 UTSW 4 14795994 missense probably benign 0.36
R8547:Lrrc69 UTSW 4 14704014 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAATCACCTGCTTAAACTTGG -3'
(R):5'- ATCTGTCTTCAACAACCAGCAG -3'

Sequencing Primer
(F):5'- CATGGTGGCACGCGTCTATAAAC -3'
(R):5'- AGCAGAACCTTGGCCGAG -3'
Posted On2014-10-15