Incidental Mutation 'R2229:Ugcg'
ID 239588
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene Name UDP-glucose ceramide glucosyltransferase
Synonyms Epcs21, Ugcgl, GlcT-1
MMRRC Submission 040230-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2229 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 59189257-59222833 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59207798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
AlphaFold O88693
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 (GRCm38) I291L probably benign Het
Adcy8 C A 15: 64,822,207 (GRCm38) R407L possibly damaging Het
Adgb A T 10: 10,436,051 (GRCm38) V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 (GRCm38) S350N probably benign Het
Agbl1 A G 7: 76,433,378 (GRCm38) T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 (GRCm38) T605R probably damaging Het
Arfip1 A T 3: 84,547,973 (GRCm38) N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 (GRCm38) probably null Het
Banp G A 8: 121,978,685 (GRCm38) S98N probably damaging Het
Btnl9 T C 11: 49,169,118 (GRCm38) D601G probably damaging Het
C9 T C 15: 6,445,420 (GRCm38) I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 (GRCm38) V744A probably damaging Het
Catsper3 A G 13: 55,808,054 (GRCm38) E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 (GRCm38) probably null Het
Cdc5l A G 17: 45,407,846 (GRCm38) Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 (GRCm38) probably benign Het
Eml4 C T 17: 83,451,056 (GRCm38) P502S probably benign Het
Fsip1 T C 2: 118,222,444 (GRCm38) E367G probably benign Het
Gja3 T C 14: 57,036,714 (GRCm38) D67G probably damaging Het
Gm4894 T C 9: 49,274,190 (GRCm38) probably benign Het
Gm7853 A G 14: 36,089,527 (GRCm38) noncoding transcript Het
Gmps T G 3: 64,014,263 (GRCm38) Y562* probably null Het
Golga2 C A 2: 32,306,465 (GRCm38) P976T probably benign Het
Gpr182 T A 10: 127,750,141 (GRCm38) I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 (GRCm38) V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 (GRCm38) T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 (GRCm38) L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 (GRCm38) L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 (GRCm38) S920P probably damaging Het
Kif3c T A 12: 3,366,671 (GRCm38) S231T probably benign Het
Kpna7 A T 5: 144,989,697 (GRCm38) Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 (GRCm38) probably benign Het
Lrrc69 T C 4: 14,773,694 (GRCm38) S121G probably benign Het
Mppe1 A G 18: 67,228,011 (GRCm38) probably null Het
Muc5b T A 7: 141,861,644 (GRCm38) C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 (GRCm38) N1893K probably damaging Het
Myo7a T C 7: 98,054,910 (GRCm38) T1932A probably benign Het
Nbn A G 4: 15,970,904 (GRCm38) T296A probably benign Het
Nckap1l T C 15: 103,455,934 (GRCm38) probably null Het
Nek5 A T 8: 22,113,632 (GRCm38) N151K possibly damaging Het
Nup93 C T 8: 94,304,191 (GRCm38) T305I probably benign Het
Oca2 T A 7: 56,357,155 (GRCm38) H663Q probably benign Het
Optn T A 2: 5,024,117 (GRCm38) H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 (GRCm38) probably benign Het
Pikfyve A G 1: 65,267,855 (GRCm38) K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 (GRCm38) V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 (GRCm38) R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 (GRCm38) R224L probably benign Het
Prpf19 A G 19: 10,897,598 (GRCm38) T39A probably benign Het
Pwwp2b T C 7: 139,255,188 (GRCm38) C182R probably damaging Het
Rcan3 T C 4: 135,425,377 (GRCm38) D11G probably benign Het
Rgsl1 C A 1: 153,822,358 (GRCm38) W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 (GRCm38) G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 (GRCm38) I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 (GRCm38) V334A probably benign Het
Smarcc2 A G 10: 128,488,341 (GRCm38) probably benign Het
Spata18 A T 5: 73,666,901 (GRCm38) I156L possibly damaging Het
Spats2 T C 15: 99,174,453 (GRCm38) probably null Het
Tas2r104 G A 6: 131,685,132 (GRCm38) H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 (GRCm38) probably benign Het
Tex15 C A 8: 33,571,237 (GRCm38) H232N probably benign Het
Tg A T 15: 66,674,011 (GRCm38) Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 (GRCm38) probably null Het
Trim25 T A 11: 89,016,621 (GRCm38) V602E probably damaging Het
Ttll9 A G 2: 152,983,063 (GRCm38) E54G probably damaging Het
Ttn T C 2: 76,729,324 (GRCm38) T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 (GRCm38) Q960R probably damaging Het
Usp13 A G 3: 32,917,551 (GRCm38) I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 (GRCm38) I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 (GRCm38) I220L probably benign Het
Wnk4 T A 11: 101,275,641 (GRCm38) probably benign Het
Wwp1 A T 4: 19,641,745 (GRCm38) Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 (GRCm38) I540T probably damaging Het
Zfp729b T C 13: 67,595,265 (GRCm38) I60M probably damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59,213,865 (GRCm38) missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59,217,216 (GRCm38) critical splice donor site probably null
IGL02636:Ugcg APN 4 59,207,763 (GRCm38) missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59,218,587 (GRCm38) splice site probably benign
IGL02798:Ugcg APN 4 59,220,346 (GRCm38) missense probably damaging 1.00
congee UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
cream_o_wheat UTSW 4 59,220,387 (GRCm38) missense possibly damaging 0.91
gruel UTSW 4 59,189,690 (GRCm38) missense probably benign
Porridge UTSW 4 59,219,530 (GRCm38) missense possibly damaging 0.86
slop UTSW 4 59,211,883 (GRCm38) missense probably benign 0.16
wheatina UTSW 4 59,220,272 (GRCm38) missense probably damaging 0.96
PIT4382001:Ugcg UTSW 4 59,213,246 (GRCm38) missense possibly damaging 0.68
R0013:Ugcg UTSW 4 59,213,931 (GRCm38) missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59,213,931 (GRCm38) missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59,217,130 (GRCm38) missense probably benign 0.16
R0068:Ugcg UTSW 4 59,217,130 (GRCm38) missense probably benign 0.16
R0119:Ugcg UTSW 4 59,217,036 (GRCm38) missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59,189,739 (GRCm38) nonsense probably null
R0299:Ugcg UTSW 4 59,217,036 (GRCm38) missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59,220,387 (GRCm38) missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59,217,036 (GRCm38) missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0688:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0726:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0802:Ugcg UTSW 4 59,189,685 (GRCm38) missense probably benign 0.00
R0803:Ugcg UTSW 4 59,189,685 (GRCm38) missense probably benign 0.00
R0811:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0812:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0828:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0831:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0944:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0945:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R0947:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1104:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1209:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1210:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1252:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1253:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1255:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1488:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1490:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1548:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1698:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1771:Ugcg UTSW 4 59,207,775 (GRCm38) missense probably benign 0.05
R1776:Ugcg UTSW 4 59,207,775 (GRCm38) missense probably benign 0.05
R1781:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1794:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R1840:Ugcg UTSW 4 59,219,517 (GRCm38) missense probably damaging 1.00
R1942:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2228:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2237:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2239:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2314:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2337:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2338:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2340:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2422:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2426:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R2433:Ugcg UTSW 4 59,207,876 (GRCm38) missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3076:Ugcg UTSW 4 59,213,922 (GRCm38) missense probably damaging 1.00
R3078:Ugcg UTSW 4 59,213,922 (GRCm38) missense probably damaging 1.00
R3689:Ugcg UTSW 4 59,211,883 (GRCm38) missense probably benign 0.16
R3732:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3732:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3733:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3766:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3767:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3768:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3769:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3771:Ugcg UTSW 4 59,189,690 (GRCm38) missense probably benign
R3847:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3848:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3916:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3917:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3958:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R3959:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R4023:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R4024:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R4025:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R4065:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R4066:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
R4427:Ugcg UTSW 4 59,219,555 (GRCm38) missense probably benign 0.02
R5842:Ugcg UTSW 4 59,219,545 (GRCm38) missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59,220,272 (GRCm38) missense probably damaging 0.96
R6080:Ugcg UTSW 4 59,218,524 (GRCm38) missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59,219,530 (GRCm38) missense possibly damaging 0.86
R7194:Ugcg UTSW 4 59,213,210 (GRCm38) missense probably damaging 0.99
R7286:Ugcg UTSW 4 59,217,111 (GRCm38) missense possibly damaging 0.95
R7362:Ugcg UTSW 4 59,217,109 (GRCm38) missense probably damaging 1.00
R7472:Ugcg UTSW 4 59,217,156 (GRCm38) missense probably benign
R7638:Ugcg UTSW 4 59,220,299 (GRCm38) missense probably benign 0.26
R7866:Ugcg UTSW 4 59,211,927 (GRCm38) missense possibly damaging 0.71
R8170:Ugcg UTSW 4 59,211,974 (GRCm38) missense possibly damaging 0.71
R8488:Ugcg UTSW 4 59,213,896 (GRCm38) missense probably benign 0.00
R8793:Ugcg UTSW 4 59,207,794 (GRCm38) missense probably benign 0.22
R9441:Ugcg UTSW 4 59,207,843 (GRCm38) missense probably damaging 1.00
Y4336:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
Y4337:Ugcg UTSW 4 59,207,798 (GRCm38) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTTGCTCCTGGTTCTTGTGTTT -3'
(R):5'- AGGCTAGGCTGTTTTCACAATCA -3'

Sequencing Primer
(F):5'- TCTAACCCAACTCTGTTCAG -3'
(R):5'- CACGTATTCTTTCATTCCCC -3'
Posted On 2014-10-15