Incidental Mutation 'R2229:Ugcg'
ID239588
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
congee UTSW 4 59207798 missense probably benign 0.17
Porridge UTSW 4 59219530 missense possibly damaging 0.86
slop UTSW 4 59211883 missense probably benign 0.16
wheatina UTSW 4 59220272 missense probably damaging 0.96
PIT4382001:Ugcg UTSW 4 59213246 missense possibly damaging 0.68
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
R7194:Ugcg UTSW 4 59213210 missense probably damaging 0.99
R7286:Ugcg UTSW 4 59217111 missense possibly damaging 0.95
R7362:Ugcg UTSW 4 59217109 missense probably damaging 1.00
R7472:Ugcg UTSW 4 59217156 missense probably benign
R7638:Ugcg UTSW 4 59220299 missense probably benign 0.26
R7866:Ugcg UTSW 4 59211927 missense possibly damaging 0.71
R8170:Ugcg UTSW 4 59211974 missense possibly damaging 0.71
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTTGCTCCTGGTTCTTGTGTTT -3'
(R):5'- AGGCTAGGCTGTTTTCACAATCA -3'

Sequencing Primer
(F):5'- TCTAACCCAACTCTGTTCAG -3'
(R):5'- CACGTATTCTTTCATTCCCC -3'
Posted On2014-10-15