Incidental Mutation 'R2229:Spata18'
ID239591
Institutional Source Beutler Lab
Gene Symbol Spata18
Ensembl Gene ENSMUSG00000029155
Gene Namespermatogenesis associated 18
Synonyms
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73651379-73679512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73666901 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 156 (I156L)
Ref Sequence ENSEMBL: ENSMUSP00000064308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041422] [ENSMUST00000071077] [ENSMUST00000113548] [ENSMUST00000178631]
Predicted Effect probably benign
Transcript: ENSMUST00000041422
SMART Domains Protein: ENSMUSP00000040922
Gene: ENSMUSG00000029155

DomainStartEndE-ValueType
coiled coil region 178 211 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000071077
AA Change: I156L

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064308
Gene: ENSMUSG00000029155
AA Change: I156L

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113548
SMART Domains Protein: ENSMUSP00000109176
Gene: ENSMUSG00000029155

DomainStartEndE-ValueType
Pfam:MIEAP 6 195 2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178631
AA Change: I42L

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137444
Gene: ENSMUSG00000029155
AA Change: I42L

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Pfam:MIEAP 296 485 1.2e-65 PFAM
Meta Mutation Damage Score 0.0821 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a p53-inducible protein that is able to induce lysosome-like organelles within mitochondria that eliminate oxidized mitochondrial proteins, thereby contributing to mitochondrial quality control. Dysregulation of mitochondrial quality control is associated with cancer and degenerative diseases. The encoded protein mediates accumulation of the lysosome-like mitochondrial organelles through interaction with B cell lymphoma 2 interacting protein 3 and B cell lymphoma 2 interacting protein 3 like at the outer mitochondrial membrane, which allows translocation of lysosomal proteins to the mitochondrial matrix from the cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homo- or heterozygous KO in mice also carrying one copy of the ApcMin allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Spata18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Spata18 APN 5 73657754 missense possibly damaging 0.80
IGL01331:Spata18 APN 5 73669681 missense probably damaging 1.00
IGL01394:Spata18 APN 5 73679345 splice site probably null
IGL01994:Spata18 APN 5 73657601 critical splice donor site probably null
IGL02192:Spata18 APN 5 73672518 splice site probably null
IGL02253:Spata18 APN 5 73668596 missense possibly damaging 0.61
IGL03195:Spata18 APN 5 73671248 missense probably damaging 1.00
IGL03204:Spata18 APN 5 73671106 splice site probably benign
ANU74:Spata18 UTSW 5 73671113 missense probably damaging 1.00
R0312:Spata18 UTSW 5 73666881 missense probably benign 0.00
R0557:Spata18 UTSW 5 73651670 missense probably damaging 1.00
R1624:Spata18 UTSW 5 73669545 missense probably damaging 0.98
R1901:Spata18 UTSW 5 73671139 missense probably damaging 1.00
R1937:Spata18 UTSW 5 73676964 missense probably damaging 1.00
R2228:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2896:Spata18 UTSW 5 73657802 missense probably damaging 1.00
R3082:Spata18 UTSW 5 73679080 intron probably benign
R3716:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R3717:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R4061:Spata18 UTSW 5 73671166 missense probably damaging 1.00
R4299:Spata18 UTSW 5 73666902 missense probably benign 0.36
R4963:Spata18 UTSW 5 73678993 missense probably damaging 0.96
R5603:Spata18 UTSW 5 73671232 missense probably benign 0.12
R6381:Spata18 UTSW 5 73675216 missense probably damaging 1.00
R6581:Spata18 UTSW 5 73669516 missense probably benign 0.14
R7062:Spata18 UTSW 5 73659293 missense probably benign 0.08
R7591:Spata18 UTSW 5 73672416 missense
R7682:Spata18 UTSW 5 73668665 missense
R7688:Spata18 UTSW 5 73651662 missense probably benign 0.14
R7783:Spata18 UTSW 5 73668610 missense
R8051:Spata18 UTSW 5 73669720 missense
X0061:Spata18 UTSW 5 73666859 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGTTTGACCAAGCAAGGGAC -3'
(R):5'- TAAAAGCCCTGCCTCATTTGC -3'

Sequencing Primer
(F):5'- CCATCAGACTGTTTGCAATGG -3'
(R):5'- CCTCATTTGCGGGGGAG -3'
Posted On2014-10-15