Incidental Mutation 'R2229:Kpna7'
ID239593
Institutional Source Beutler Lab
Gene Symbol Kpna7
Ensembl Gene ENSMUSG00000038770
Gene Namekaryopherin alpha 7 (importin alpha 8)
SynonymsLOC381686
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144983519-145084030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144989697 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 482 (Y482N)
Ref Sequence ENSEMBL: ENSMUSP00000112155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110672] [ENSMUST00000110673] [ENSMUST00000116454]
Predicted Effect probably damaging
Transcript: ENSMUST00000110672
AA Change: Y482N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106300
Gene: ENSMUSG00000038770
AA Change: Y482N

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110673
AA Change: Y503N

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106301
Gene: ENSMUSG00000038770
AA Change: Y503N

DomainStartEndE-ValueType
Pfam:IBB 6 90 2.7e-19 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 3.31e-10 SMART
ARM 206 247 1.78e-1 SMART
ARM 250 289 4.28e-4 SMART
ARM 291 331 1.19e-2 SMART
ARM 333 373 5.27e-4 SMART
ARM 375 414 2.85e0 SMART
ARM 417 457 8.17e-1 SMART
Pfam:Arm_3 466 517 8.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116454
AA Change: Y482N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112155
Gene: ENSMUSG00000038770
AA Change: Y482N

DomainStartEndE-ValueType
Pfam:IBB 2 91 1.7e-14 PFAM
ARM 100 141 1.4e-8 SMART
ARM 143 183 6.18e-10 SMART
ARM 185 226 1.78e-1 SMART
ARM 229 268 4.28e-4 SMART
ARM 270 310 1.19e-2 SMART
ARM 312 352 5.27e-4 SMART
ARM 354 393 2.85e0 SMART
ARM 396 436 8.17e-1 SMART
low complexity region 486 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142866
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import, but exhibits different nuclear localization signal binding specificity compared to other members of the family. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display smaller litter sizes with preferential loss of females and accelerated cell cycles post fertilization resulting in loss of embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Kpna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Kpna7 APN 5 145007246 missense probably damaging 1.00
IGL01505:Kpna7 APN 5 144992851 missense probably damaging 1.00
IGL02009:Kpna7 APN 5 144994078 critical splice acceptor site probably null
IGL02365:Kpna7 APN 5 144985733 missense possibly damaging 0.49
IGL02947:Kpna7 APN 5 144994074 missense probably damaging 1.00
IGL03195:Kpna7 APN 5 144997037 missense probably damaging 1.00
IGL03236:Kpna7 APN 5 144985694 missense unknown
IGL03333:Kpna7 APN 5 145005955 missense possibly damaging 0.48
PIT4515001:Kpna7 UTSW 5 145005052 missense probably benign 0.17
R0027:Kpna7 UTSW 5 144989697 missense probably damaging 0.99
R0421:Kpna7 UTSW 5 144989741 missense possibly damaging 0.82
R0463:Kpna7 UTSW 5 145007994 missense possibly damaging 0.66
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2871:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2873:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R2874:Kpna7 UTSW 5 144993935 missense probably benign 0.06
R4079:Kpna7 UTSW 5 145005927 missense possibly damaging 0.82
R5841:Kpna7 UTSW 5 144993956 missense possibly damaging 0.73
R5888:Kpna7 UTSW 5 144989795 missense probably damaging 0.98
R6188:Kpna7 UTSW 5 144992844 missense probably damaging 1.00
R7163:Kpna7 UTSW 5 145002396 missense unknown
R7502:Kpna7 UTSW 5 145005921 missense probably benign 0.07
R7727:Kpna7 UTSW 5 145005045 missense probably benign 0.19
X0021:Kpna7 UTSW 5 145007233 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCATCCATCTTGCCGACGAC -3'
(R):5'- CTGGATCAGGTCTGCCTCTAAC -3'

Sequencing Primer
(F):5'- CATGGATCAACAAGCCTGGGTTTC -3'
(R):5'- AGCTGAAGTTCCACGTGCAC -3'
Posted On2014-10-15