Incidental Mutation 'R2229:Oca2'
Institutional Source Beutler Lab
Gene Symbol Oca2
Ensembl Gene ENSMUSG00000030450
Gene Nameoculocutaneous albinism II
SynonymsD7H15S12, p, D7H15S12
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosomal Location56239760-56536518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56357155 bp
Amino Acid Change Histidine to Glutamine at position 663 (H663Q)
Ref Sequence ENSEMBL: ENSMUSP00000032633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032633] [ENSMUST00000144739] [ENSMUST00000152693]
Predicted Effect probably benign
Transcript: ENSMUST00000032633
AA Change: H663Q

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: H663Q

transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144739
Predicted Effect probably benign
Transcript: ENSMUST00000152693
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

transmembrane domain 171 193 N/A INTRINSIC
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Oca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
R7257:Oca2 UTSW 7 56279538 intron probably benign
R7409:Oca2 UTSW 7 56414397 missense probably benign 0.00
R7530:Oca2 UTSW 7 56331972 missense probably damaging 0.99
R7820:Oca2 UTSW 7 56331965 missense probably damaging 1.00
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-15