Mutagenetix > Incidental Mutation

Incidental Mutation 'R2229:Tex15'

239606

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

040230-MU

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene?

Possibly non essential (E-score: 0.294) question?

Stock #

R2229 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 33571237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 232 (H232N)

Ref Sequence

ENSEMBL: ENSMUSP00000009772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000009772
AA Change: H232N

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: H232N

Domain	Start	End	E-Value	Type
low complexity region	262	274	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	524	536	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	713	725	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1497	1508	N/A	INTRINSIC
Pfam:TEX15	1572	1788	1.3e-109	PFAM
Pfam:TEX15	1901	2119	1.1e-16	PFAM
low complexity region	2758	2770	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124496
AA Change: H506N

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: H506N

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	251	1.6e-58	PFAM
low complexity region	536	548	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	798	810	N/A	INTRINSIC
low complexity region	939	948	N/A	INTRINSIC
low complexity region	987	999	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

99% (78/79)

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam24	A	T	8: 40,680,365	I291L	probably benign	Het
Adcy8	C	A	15: 64,822,207	R407L	possibly damaging	Het
Adgb	A	T	10: 10,436,051	V212E	probably damaging	Het
Adgrg7	C	T	16: 56,752,403	S350N	probably benign	Het
Agbl1	A	G	7: 76,433,378	T448A	probably benign	Het
Aldh1l1	C	G	6: 90,583,186	T605R	probably damaging	Het
Arfip1	A	T	3: 84,547,973	N18K	probably damaging	Het
Atp6v1b2	C	A	8: 69,102,759		probably null	Het
Banp	G	A	8: 121,978,685	S98N	probably damaging	Het
Btnl9	T	C	11: 49,169,118	D601G	probably damaging	Het
C9	T	C	15: 6,445,420	I20T	possibly damaging	Het
Cacna1b	A	G	2: 24,685,804	V744A	probably damaging	Het
Catsper3	A	G	13: 55,808,054	E311G	probably damaging	Het
Ccdc180	G	T	4: 45,948,856		probably null	Het
Cdc5l	A	G	17: 45,407,846	Y615H	probably benign	Het
Crybg2	TGGAGGAGGAGGAGGAGGAG	TGGAGGAGGAGGAGGAG	4: 134,074,526		probably benign	Het
Eml4	C	T	17: 83,451,056	P502S	probably benign	Het
Fsip1	T	C	2: 118,222,444	E367G	probably benign	Het
Gja3	T	C	14: 57,036,714	D67G	probably damaging	Het
Gm4894	T	C	9: 49,274,190		probably benign	Het
Gm7853	A	G	14: 36,089,527		noncoding transcript	Het
Gmps	T	G	3: 64,014,263	Y562*	probably null	Het
Golga2	C	A	2: 32,306,465	P976T	probably benign	Het
Gpr182	T	A	10: 127,750,141	I314F	possibly damaging	Het
Gprc6a	A	G	10: 51,626,795	V324A	possibly damaging	Het
Gykl1	A	G	18: 52,695,267	T516A	probably benign	Het
Hist2h2ab	T	C	3: 96,220,106	L64P	possibly damaging	Het
Ifit1bl2	G	T	19: 34,619,230	L329M	possibly damaging	Het
Igsf9b	T	C	9: 27,333,496	S920P	probably damaging	Het
Kif3c	T	A	12: 3,366,671	S231T	probably benign	Het
Kpna7	A	T	5: 144,989,697	Y482N	probably damaging	Het
Lmnb2	T	C	10: 80,904,392		probably benign	Het
Lrrc69	T	C	4: 14,773,694	S121G	probably benign	Het
Mppe1	A	G	18: 67,228,011		probably null	Het
Muc5b	T	A	7: 141,861,644	C2776S	possibly damaging	Het
Myh8	T	G	11: 67,308,348	N1893K	probably damaging	Het
Myo7a	T	C	7: 98,054,910	T1932A	probably benign	Het
Nbn	A	G	4: 15,970,904	T296A	probably benign	Het
Nckap1l	T	C	15: 103,455,934		probably null	Het
Nek5	A	T	8: 22,113,632	N151K	possibly damaging	Het
Nup93	C	T	8: 94,304,191	T305I	probably benign	Het
Oca2	T	A	7: 56,357,155	H663Q	probably benign	Het
Optn	T	A	2: 5,024,117	H525L	probably damaging	Het
Pdzph1	A	G	17: 58,932,412		probably benign	Het
Pikfyve	A	G	1: 65,267,855	K1801E	probably damaging	Het
Pkd2l2	G	A	18: 34,430,329	V478M	probably damaging	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Ppp1r3c	C	A	19: 36,733,698	R224L	probably benign	Het
Prpf19	A	G	19: 10,897,598	T39A	probably benign	Het
Pwwp2b	T	C	7: 139,255,188	C182R	probably damaging	Het
Rcan3	T	C	4: 135,425,377	D11G	probably benign	Het
Rgsl1	C	A	1: 153,822,358	W482L	possibly damaging	Het
Sfxn4	C	T	19: 60,851,020	G200E	probably damaging	Het
Slc4a8	T	C	15: 100,809,299	I848T	probably damaging	Het
Slc7a13	T	C	4: 19,839,399	V334A	probably benign	Het
Smarcc2	A	G	10: 128,488,341		probably benign	Het
Spata18	A	T	5: 73,666,901	I156L	possibly damaging	Het
Spats2	T	C	15: 99,174,453		probably null	Het
Tas2r104	G	A	6: 131,685,132	H205Y	probably damaging	Het
Tcof1	A	G	18: 60,832,177		probably benign	Het
Tg	A	T	15: 66,674,011	Q194L	probably damaging	Het
Tnfrsf22	C	T	7: 143,644,776		probably null	Het
Trim25	T	A	11: 89,016,621	V602E	probably damaging	Het
Ttll9	A	G	2: 152,983,063	E54G	probably damaging	Het
Ttn	T	C	2: 76,729,324	T29578A	probably damaging	Het
Tubgcp5	A	G	7: 55,830,881	Q960R	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp13	A	G	3: 32,917,551	I727V	probably benign	Het
Vmn2r67	T	A	7: 85,152,042	I229F	probably benign	Het
Vmn2r92	A	C	17: 18,167,392	I220L	probably benign	Het
Wnk4	T	A	11: 101,275,641		probably benign	Het
Wwp1	A	T	4: 19,641,745	Y437N	probably damaging	Het
Zdhhc5	A	G	2: 84,690,213	I540T	probably damaging	Het
Zfp729b	T	C	13: 67,595,265	I60M	probably damaging	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R6970:Tex15	UTSW	8	33557428	missense	probably benign	0.03
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
R8670:Tex15	UTSW	8	33574718	missense	probably benign	0.19
R8703:Tex15	UTSW	8	33572696	missense	probably benign	0.00
R8871:Tex15	UTSW	8	33576964	missense	possibly damaging	0.62
R8945:Tex15	UTSW	8	33574696	missense	probably benign	0.00
R9104:Tex15	UTSW	8	33570922	missense	possibly damaging	0.86
R9132:Tex15	UTSW	8	33577526	missense	possibly damaging	0.84
R9207:Tex15	UTSW	8	33575756	missense	probably damaging	1.00
R9210:Tex15	UTSW	8	33574291	missense	possibly damaging	0.91
R9330:Tex15	UTSW	8	33575115	missense	probably benign	0.01
R9354:Tex15	UTSW	8	33573316	missense	possibly damaging	0.86
R9365:Tex15	UTSW	8	33574536	missense	possibly damaging	0.56
R9440:Tex15	UTSW	8	33582245	missense	possibly damaging	0.90
R9534:Tex15	UTSW	8	33570971	missense	probably benign	0.45
R9570:Tex15	UTSW	8	33577281	missense	probably damaging	0.96
R9574:Tex15	UTSW	8	33574481	missense	probably benign	0.09
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- CAAAAGTGATACTGCAGGTTTGAGTG -3'
(R):5'- TGACTCACTGCTCAGAGCTG -3'

Sequencing Primer
(F):5'- AGTGATGTTTTGCCATTGGATAAGAG -3'
(R):5'- CTGCTCAGAGCTGTTAAAACTGG -3'

Posted On

2014-10-15