Incidental Mutation 'R2229:Adam24'
Institutional Source Beutler Lab
Gene Symbol Adam24
Ensembl Gene ENSMUSG00000046723
Gene Namea disintegrin and metallopeptidase domain 24 (testase 1)
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosomal Location40675077-40682199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40680365 bp
Amino Acid Change Isoleucine to Leucine at position 291 (I291L)
Ref Sequence ENSEMBL: ENSMUSP00000050727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051614]
Predicted Effect probably benign
Transcript: ENSMUST00000051614
AA Change: I291L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050727
Gene: ENSMUSG00000046723
AA Change: I291L

signal peptide 1 34 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 160 3.3e-14 PFAM
Pfam:Reprolysin_2 193 389 6.3e-13 PFAM
Pfam:Reprolysin 208 398 7.8e-43 PFAM
Pfam:Reprolysin_5 209 382 3e-17 PFAM
Pfam:Reprolysin_4 209 392 4.9e-13 PFAM
Pfam:Reprolysin_3 232 353 9.9e-16 PFAM
DISIN 415 491 7.13e-39 SMART
ACR 492 628 7.74e-69 SMART
transmembrane domain 698 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210267
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Male mice lacking the encoded protein exhibit reduced fertility due to the higher incidence of polyspermic embryos. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile and produce an increased number of polyspermic embryos at the pronuclear stage. Female homozygotes show normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Adam24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Adam24 APN 8 40679532 missense probably benign 0.41
IGL02517:Adam24 APN 8 40680179 missense probably damaging 1.00
R0195:Adam24 UTSW 8 40681766 missense probably benign 0.00
R1067:Adam24 UTSW 8 40680754 nonsense probably null
R1180:Adam24 UTSW 8 40681428 missense probably damaging 1.00
R1438:Adam24 UTSW 8 40681392 missense probably benign 0.19
R1741:Adam24 UTSW 8 40679603 missense probably benign 0.00
R1779:Adam24 UTSW 8 40680965 missense possibly damaging 0.83
R1940:Adam24 UTSW 8 40681361 nonsense probably null
R2228:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2265:Adam24 UTSW 8 40680071 missense possibly damaging 0.95
R2359:Adam24 UTSW 8 40680945 missense possibly damaging 0.91
R3551:Adam24 UTSW 8 40679593 missense probably benign 0.03
R3837:Adam24 UTSW 8 40680545 missense probably benign
R4834:Adam24 UTSW 8 40679699 missense probably damaging 1.00
R5121:Adam24 UTSW 8 40679511 missense probably damaging 1.00
R5410:Adam24 UTSW 8 40681064 missense probably benign 0.01
R5787:Adam24 UTSW 8 40680902 missense possibly damaging 0.87
R5900:Adam24 UTSW 8 40681032 missense probably benign 0.00
R6600:Adam24 UTSW 8 40680548 missense probably damaging 1.00
R6633:Adam24 UTSW 8 40680487 missense probably benign 0.12
R6672:Adam24 UTSW 8 40681533 missense probably benign 0.01
R6904:Adam24 UTSW 8 40681503 missense probably damaging 1.00
R7178:Adam24 UTSW 8 40680000 nonsense probably null
R7542:Adam24 UTSW 8 40680809 missense possibly damaging 0.46
R7578:Adam24 UTSW 8 40680255 missense probably benign 0.01
R7708:Adam24 UTSW 8 40680519 missense probably damaging 1.00
R8739:Adam24 UTSW 8 40680441 missense possibly damaging 0.68
X0010:Adam24 UTSW 8 40680015 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-15