Incidental Mutation 'R2229:Banp'
ID 239610
Institutional Source Beutler Lab
Gene Symbol Banp
Ensembl Gene ENSMUSG00000025316
Gene Name BTG3 associated nuclear protein
Synonyms SMAR1
MMRRC Submission 040230-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.912) question?
Stock # R2229 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 122676489-122755997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 122705424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 98 (S98N)
Ref Sequence ENSEMBL: ENSMUSP00000133783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026354] [ENSMUST00000093078] [ENSMUST00000127664] [ENSMUST00000170857] [ENSMUST00000172511] [ENSMUST00000172628] [ENSMUST00000173254] [ENSMUST00000174753] [ENSMUST00000174445] [ENSMUST00000172681]
AlphaFold Q8VBU8
Predicted Effect probably damaging
Transcript: ENSMUST00000026354
AA Change: S98N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026354
Gene: ENSMUSG00000025316
AA Change: S98N

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
BEN 218 291 6.7e-21 SMART
low complexity region 301 315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093078
AA Change: S98N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090766
Gene: ENSMUSG00000025316
AA Change: S98N

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
BEN 218 291 6.7e-21 SMART
low complexity region 301 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170857
AA Change: S98N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132095
Gene: ENSMUSG00000025316
AA Change: S98N

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
BEN 257 330 6.7e-21 SMART
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172511
AA Change: S98N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133365
Gene: ENSMUSG00000025316
AA Change: S98N

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172513
Predicted Effect probably benign
Transcript: ENSMUST00000172628
AA Change: S136N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133342
Gene: ENSMUSG00000025316
AA Change: S136N

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
coiled coil region 99 136 N/A INTRINSIC
low complexity region 182 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173254
AA Change: S98N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133783
Gene: ENSMUSG00000025316
AA Change: S98N

DomainStartEndE-ValueType
coiled coil region 61 98 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
BEN 257 330 6.7e-21 SMART
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174753
AA Change: S90N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134058
Gene: ENSMUSG00000025316
AA Change: S90N

DomainStartEndE-ValueType
coiled coil region 52 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184699
Predicted Effect probably benign
Transcript: ENSMUST00000174445
Predicted Effect probably benign
Transcript: ENSMUST00000172681
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 41,133,404 (GRCm39) I291L probably benign Het
Adcy8 C A 15: 64,694,056 (GRCm39) R407L possibly damaging Het
Adgb A T 10: 10,311,795 (GRCm39) V212E probably damaging Het
Adgrg7 C T 16: 56,572,766 (GRCm39) S350N probably benign Het
Agbl1 A G 7: 76,083,126 (GRCm39) T448A probably benign Het
Aldh1l1 C G 6: 90,560,168 (GRCm39) T605R probably damaging Het
Arfip1 A T 3: 84,455,280 (GRCm39) N18K probably damaging Het
Atp6v1b2 C A 8: 69,555,411 (GRCm39) probably null Het
Btnl9 T C 11: 49,059,945 (GRCm39) D601G probably damaging Het
C9 T C 15: 6,474,901 (GRCm39) I20T possibly damaging Het
Cacna1b A G 2: 24,575,816 (GRCm39) V744A probably damaging Het
Catsper3 A G 13: 55,955,867 (GRCm39) E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 (GRCm39) probably null Het
Cdc5l A G 17: 45,718,772 (GRCm39) Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 133,801,837 (GRCm39) probably benign Het
Eml4 C T 17: 83,758,485 (GRCm39) P502S probably benign Het
Fsip1 T C 2: 118,052,925 (GRCm39) E367G probably benign Het
Gja3 T C 14: 57,274,171 (GRCm39) D67G probably damaging Het
Gm4894 T C 9: 49,185,490 (GRCm39) probably benign Het
Gm7853 A G 14: 35,811,484 (GRCm39) noncoding transcript Het
Gmps T G 3: 63,921,684 (GRCm39) Y562* probably null Het
Golga2 C A 2: 32,196,477 (GRCm39) P976T probably benign Het
Gpr182 T A 10: 127,586,010 (GRCm39) I314F possibly damaging Het
Gprc6a A G 10: 51,502,891 (GRCm39) V324A possibly damaging Het
Gykl1 A G 18: 52,828,339 (GRCm39) T516A probably benign Het
H2ac21 T C 3: 96,127,422 (GRCm39) L64P possibly damaging Het
Ifit1bl2 G T 19: 34,596,630 (GRCm39) L329M possibly damaging Het
Igsf9b T C 9: 27,244,792 (GRCm39) S920P probably damaging Het
Kif3c T A 12: 3,416,671 (GRCm39) S231T probably benign Het
Kpna7 A T 5: 144,926,507 (GRCm39) Y482N probably damaging Het
Lmnb2 T C 10: 80,740,226 (GRCm39) probably benign Het
Lrrc69 T C 4: 14,773,694 (GRCm39) S121G probably benign Het
Mppe1 A G 18: 67,361,082 (GRCm39) probably null Het
Muc5b T A 7: 141,415,381 (GRCm39) C2776S possibly damaging Het
Myh8 T G 11: 67,199,174 (GRCm39) N1893K probably damaging Het
Myo7a T C 7: 97,704,117 (GRCm39) T1932A probably benign Het
Nbn A G 4: 15,970,904 (GRCm39) T296A probably benign Het
Nckap1l T C 15: 103,364,361 (GRCm39) probably null Het
Nek5 A T 8: 22,603,648 (GRCm39) N151K possibly damaging Het
Nup93 C T 8: 95,030,819 (GRCm39) T305I probably benign Het
Oca2 T A 7: 56,006,903 (GRCm39) H663Q probably benign Het
Optn T A 2: 5,028,928 (GRCm39) H525L probably damaging Het
Pdzph1 A G 17: 59,239,407 (GRCm39) probably benign Het
Pikfyve A G 1: 65,307,014 (GRCm39) K1801E probably damaging Het
Pkd2l2 G A 18: 34,563,382 (GRCm39) V478M probably damaging Het
Pmepa1 G A 2: 173,069,926 (GRCm39) R210W probably damaging Het
Ppp1r3c C A 19: 36,711,098 (GRCm39) R224L probably benign Het
Prpf19 A G 19: 10,874,962 (GRCm39) T39A probably benign Het
Pwwp2b T C 7: 138,835,104 (GRCm39) C182R probably damaging Het
Rcan3 T C 4: 135,152,688 (GRCm39) D11G probably benign Het
Rgsl1 C A 1: 153,698,104 (GRCm39) W482L possibly damaging Het
Sfxn4 C T 19: 60,839,458 (GRCm39) G200E probably damaging Het
Slc4a8 T C 15: 100,707,180 (GRCm39) I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 (GRCm39) V334A probably benign Het
Smarcc2 A G 10: 128,324,210 (GRCm39) probably benign Het
Spata18 A T 5: 73,824,244 (GRCm39) I156L possibly damaging Het
Spats2 T C 15: 99,072,334 (GRCm39) probably null Het
Tas2r104 G A 6: 131,662,095 (GRCm39) H205Y probably damaging Het
Tcof1 A G 18: 60,965,249 (GRCm39) probably benign Het
Tex15 C A 8: 34,061,265 (GRCm39) H232N probably benign Het
Tg A T 15: 66,545,860 (GRCm39) Q194L probably damaging Het
Tnfrsf22 C T 7: 143,198,513 (GRCm39) probably null Het
Trim25 T A 11: 88,907,447 (GRCm39) V602E probably damaging Het
Ttll9 A G 2: 152,824,983 (GRCm39) E54G probably damaging Het
Ttn T C 2: 76,559,668 (GRCm39) T29578A probably damaging Het
Tubgcp5 A G 7: 55,480,629 (GRCm39) Q960R probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Usp13 A G 3: 32,971,700 (GRCm39) I727V probably benign Het
Vmn2r67 T A 7: 84,801,250 (GRCm39) I229F probably benign Het
Vmn2r92 A C 17: 18,387,654 (GRCm39) I220L probably benign Het
Wnk4 T A 11: 101,166,467 (GRCm39) probably benign Het
Wwp1 A T 4: 19,641,745 (GRCm39) Y437N probably damaging Het
Zdhhc5 A G 2: 84,520,557 (GRCm39) I540T probably damaging Het
Zfp729b T C 13: 67,743,384 (GRCm39) I60M probably damaging Het
Other mutations in Banp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Banp APN 8 122,733,830 (GRCm39) missense probably benign 0.02
IGL02981:Banp APN 8 122,705,303 (GRCm39) missense possibly damaging 0.89
PIT4418001:Banp UTSW 8 122,732,365 (GRCm39) missense probably damaging 1.00
R0926:Banp UTSW 8 122,747,294 (GRCm39) missense probably benign
R1209:Banp UTSW 8 122,702,656 (GRCm39) missense possibly damaging 0.79
R1635:Banp UTSW 8 122,727,750 (GRCm39) missense probably damaging 1.00
R2269:Banp UTSW 8 122,702,662 (GRCm39) missense probably benign 0.01
R3052:Banp UTSW 8 122,732,426 (GRCm39) splice site probably null
R5155:Banp UTSW 8 122,727,759 (GRCm39) missense probably damaging 1.00
R5554:Banp UTSW 8 122,718,334 (GRCm39) missense probably damaging 1.00
R6479:Banp UTSW 8 122,718,176 (GRCm39) splice site probably null
R7376:Banp UTSW 8 122,701,236 (GRCm39) missense probably damaging 0.99
R7468:Banp UTSW 8 122,676,588 (GRCm39) critical splice donor site probably null
R7646:Banp UTSW 8 122,750,775 (GRCm39) missense possibly damaging 0.94
R7702:Banp UTSW 8 122,705,326 (GRCm39) nonsense probably null
R7832:Banp UTSW 8 122,747,291 (GRCm39) missense probably benign
R8784:Banp UTSW 8 122,727,852 (GRCm39) missense probably damaging 0.98
R8793:Banp UTSW 8 122,750,743 (GRCm39) missense probably benign 0.01
R9005:Banp UTSW 8 122,705,441 (GRCm39) missense possibly damaging 0.76
R9106:Banp UTSW 8 122,705,372 (GRCm39) missense possibly damaging 0.62
R9790:Banp UTSW 8 122,701,285 (GRCm39) missense probably benign 0.00
R9791:Banp UTSW 8 122,701,285 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTAAGGACTTGCTGCTCAC -3'
(R):5'- GTCTAAGTGAAACCAGCCCC -3'

Sequencing Primer
(F):5'- TGCTGCTCACAGTGGAAGACATC -3'
(R):5'- GAAGCACCAGGGCAGATATCC -3'
Posted On 2014-10-15