Incidental Mutation 'R2229:Gpr182'
ID239616
Institutional Source Beutler Lab
Gene Symbol Gpr182
Ensembl Gene ENSMUSG00000058396
Gene NameG protein-coupled receptor 182
SynonymsG10-D, NOW, Gpcr22, Admr, Gpcr17, AM-R
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127747276-127751732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127750141 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 314 (I314F)
Ref Sequence ENSEMBL: ENSMUSP00000100882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]
Predicted Effect probably benign
Transcript: ENSMUST00000054287
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079692
AA Change: I314F

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396
AA Change: I314F

DomainStartEndE-ValueType
Pfam:7tm_1 66 316 1.2e-40 PFAM
low complexity region 340 352 N/A INTRINSIC
Meta Mutation Damage Score 0.2517 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Gpr182
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Gpr182 APN 10 127750690 missense probably benign 0.09
IGL00983:Gpr182 APN 10 127750788 missense possibly damaging 0.89
IGL01337:Gpr182 APN 10 127750786 missense possibly damaging 0.95
IGL01810:Gpr182 APN 10 127750864 missense probably damaging 1.00
R0449:Gpr182 UTSW 10 127750696 missense probably damaging 1.00
R0554:Gpr182 UTSW 10 127751071 missense probably benign 0.00
R2292:Gpr182 UTSW 10 127750182 missense possibly damaging 0.89
R2349:Gpr182 UTSW 10 127750937 missense probably damaging 1.00
R2445:Gpr182 UTSW 10 127750627 missense probably benign 0.01
R5977:Gpr182 UTSW 10 127750879 missense possibly damaging 0.79
R6290:Gpr182 UTSW 10 127751024 missense probably benign 0.00
R6415:Gpr182 UTSW 10 127750506 missense possibly damaging 0.88
R8014:Gpr182 UTSW 10 127751005 missense possibly damaging 0.59
R8093:Gpr182 UTSW 10 127750914 missense probably damaging 1.00
R8333:Gpr182 UTSW 10 127749921 missense probably benign 0.08
R8543:Gpr182 UTSW 10 127750992 missense probably benign 0.43
R8788:Gpr182 UTSW 10 127750660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTACAGAATTGCAGAGTG -3'
(R):5'- GGCTTACATAGTTGTCTTTGCC -3'

Sequencing Primer
(F):5'- ACGCCTGAACGTTTCGGATG -3'
(R):5'- ACATAGTTGTCTTTGCCATCTGCTG -3'
Posted On2014-10-15