Incidental Mutation 'R2229:Btnl9'
ID239618
Institutional Source Beutler Lab
Gene Symbol Btnl9
Ensembl Gene ENSMUSG00000040283
Gene Namebutyrophilin-like 9
Synonyms
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49165585-49187159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49169118 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 601 (D601G)
Ref Sequence ENSEMBL: ENSMUSP00000066598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000066531]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046522
AA Change: D516G

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283
AA Change: D516G

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066531
AA Change: D601G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066598
Gene: ENSMUSG00000040283
AA Change: D601G

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_3 155 231 1e-4 PFAM
Pfam:C2-set_2 156 238 2.2e-6 PFAM
transmembrane domain 360 382 N/A INTRINSIC
PRY 419 462 3.61e-2 SMART
SPRY 463 588 1.3e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131363
Meta Mutation Damage Score 0.3467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Btnl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Btnl9 APN 11 49175691 missense probably damaging 1.00
IGL01923:Btnl9 APN 11 49180582 missense probably benign 0.00
IGL02129:Btnl9 APN 11 49169273 missense probably damaging 1.00
IGL02248:Btnl9 APN 11 49180798 missense probably benign 0.27
IGL02795:Btnl9 APN 11 49174867 splice site probably benign
IGL02889:Btnl9 APN 11 49178777 missense probably damaging 1.00
IGL02796:Btnl9 UTSW 11 49169181 missense probably damaging 0.99
R0084:Btnl9 UTSW 11 49178779 missense possibly damaging 0.91
R0362:Btnl9 UTSW 11 49169616 missense possibly damaging 0.73
R0417:Btnl9 UTSW 11 49175595 missense probably damaging 1.00
R1199:Btnl9 UTSW 11 49180747 missense probably damaging 1.00
R1260:Btnl9 UTSW 11 49169544 missense probably damaging 0.98
R1802:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R2000:Btnl9 UTSW 11 49169121 missense probably benign 0.04
R2068:Btnl9 UTSW 11 49169563 missense probably damaging 0.98
R2130:Btnl9 UTSW 11 49180696 missense probably damaging 0.99
R2142:Btnl9 UTSW 11 49170626 splice site probably null
R2255:Btnl9 UTSW 11 49169316 nonsense probably null
R2386:Btnl9 UTSW 11 49178775 missense probably damaging 1.00
R3177:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3277:Btnl9 UTSW 11 49169676 missense probably damaging 1.00
R3835:Btnl9 UTSW 11 49180685 missense probably damaging 1.00
R5287:Btnl9 UTSW 11 49169607 missense probably benign 0.20
R5352:Btnl9 UTSW 11 49178840 missense probably benign 0.01
R5433:Btnl9 UTSW 11 49176003 intron probably benign
R5490:Btnl9 UTSW 11 49169568 missense probably damaging 1.00
R5576:Btnl9 UTSW 11 49178885 missense probably benign 0.00
R6008:Btnl9 UTSW 11 49182965 critical splice donor site probably null
R6770:Btnl9 UTSW 11 49175565 splice site probably null
R7126:Btnl9 UTSW 11 49169255 missense probably damaging 1.00
R7276:Btnl9 UTSW 11 49175790 missense probably benign 0.06
R7787:Btnl9 UTSW 11 49176039 missense unknown
R7923:Btnl9 UTSW 11 49180738 missense probably damaging 0.97
R8050:Btnl9 UTSW 11 49175615 missense probably benign 0.25
R8558:Btnl9 UTSW 11 49180792 missense probably benign 0.00
R8788:Btnl9 UTSW 11 49175787 missense probably benign 0.03
X0026:Btnl9 UTSW 11 49169241 missense probably damaging 1.00
Z1192:Btnl9 UTSW 11 49175978 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCAAAGGTGAACTCATTGCTTATG -3'
(R):5'- TCAACGTGTCTGATGGCTCG -3'

Sequencing Primer
(F):5'- TCTAGACTTTTGCAGGATCCAC -3'
(R):5'- GATGGCTCGCACATCTTCAG -3'
Posted On2014-10-15