Incidental Mutation 'R2229:Trim25'
ID 239620
Institutional Source Beutler Lab
Gene Symbol Trim25
Ensembl Gene ENSMUSG00000000275
Gene Name tripartite motif-containing 25
Synonyms estrogen-responsive finger protein, Zfp147
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2229 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 88999376-89020293 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89016621 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 602 (V602E)
Ref Sequence ENSEMBL: ENSMUSP00000103528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000284] [ENSMUST00000100627] [ENSMUST00000107896]
AlphaFold Q61510
PDB Structure PRY-SPRY domain of Trim25 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000000284
AA Change: V594E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000284
Gene: ENSMUSG00000000275
AA Change: V594E

RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 5e-34 BLAST
PDB:4LTB|B 189 380 7e-69 PDB
PRY 453 505 3.44e-17 SMART
SPRY 506 626 9.62e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100627
SMART Domains Protein: ENSMUSP00000098192
Gene: ENSMUSG00000000275

RING 13 53 8.04e-9 SMART
Blast:BBOX 151 186 3e-8 BLAST
Blast:SPEC 189 288 2e-37 BLAST
PDB:4LTB|B 189 380 2e-71 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107896
AA Change: V602E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103528
Gene: ENSMUSG00000000275
AA Change: V602E

RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 3e-34 BLAST
PDB:4LTB|B 189 380 8e-69 PDB
low complexity region 382 393 N/A INTRINSIC
PRY 461 513 3.44e-17 SMART
SPRY 514 634 9.62e-31 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations result in a compromised response to estrogen resulting in functional but small uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Trim25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Trim25 APN 11 88999691 missense probably damaging 0.96
IGL02398:Trim25 APN 11 88999804 missense probably damaging 1.00
IGL03150:Trim25 APN 11 89000005 missense probably damaging 1.00
R0003:Trim25 UTSW 11 89015772 missense probably benign 0.01
R0184:Trim25 UTSW 11 88999640 missense probably damaging 1.00
R0707:Trim25 UTSW 11 88999738 missense probably benign 0.03
R1855:Trim25 UTSW 11 89015581 missense probably benign 0.04
R1936:Trim25 UTSW 11 89004750 missense probably benign 0.03
R3401:Trim25 UTSW 11 89010881 missense probably benign
R5159:Trim25 UTSW 11 88999532 missense probably benign 0.20
R5378:Trim25 UTSW 11 89009267 missense probably damaging 1.00
R6149:Trim25 UTSW 11 89015536 missense probably benign 0.00
R6867:Trim25 UTSW 11 89010887 missense probably benign 0.00
R6996:Trim25 UTSW 11 88999503 missense probably benign 0.00
R7055:Trim25 UTSW 11 88999924 missense probably benign
R7310:Trim25 UTSW 11 89015782 missense probably benign 0.03
R7451:Trim25 UTSW 11 89015737 missense possibly damaging 0.76
R7632:Trim25 UTSW 11 89015776 missense probably null 0.91
R7767:Trim25 UTSW 11 89009117 critical splice acceptor site probably null
R8132:Trim25 UTSW 11 89016606 missense probably damaging 0.99
R8785:Trim25 UTSW 11 89013514 missense probably benign 0.00
R8978:Trim25 UTSW 11 89016201 missense probably benign 0.01
R9135:Trim25 UTSW 11 89009162 missense probably benign
R9189:Trim25 UTSW 11 89010905 missense probably benign 0.00
R9348:Trim25 UTSW 11 89009341 nonsense probably null
R9667:Trim25 UTSW 11 89016362 missense not run
X0022:Trim25 UTSW 11 89015596 missense probably benign 0.05
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-15