Incidental Mutation 'R2229:Wnk4'
ID239621
Institutional Source Beutler Lab
Gene Symbol Wnk4
Ensembl Gene ENSMUSG00000035112
Gene NameWNK lysine deficient protein kinase 4
Synonyms2010002J11Rik, Prkwnk4
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101260567-101277409 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 101275641 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000017332] [ENSMUST00000103107] [ENSMUST00000103108] [ENSMUST00000139487] [ENSMUST00000147741] [ENSMUST00000168089] [ENSMUST00000170056]
Predicted Effect probably benign
Transcript: ENSMUST00000017332
SMART Domains Protein: ENSMUSP00000017332
Gene: ENSMUSG00000017188

DomainStartEndE-ValueType
Pfam:Coiled-coil_56 1 106 1.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103107
SMART Domains Protein: ENSMUSP00000099396
Gene: ENSMUSG00000078653

DomainStartEndE-ValueType
Pfam:Cyclin_N 111 180 1.8e-6 PFAM
low complexity region 212 221 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103108
AA Change: N971K
SMART Domains Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: N971K

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 427 4.7e-42 PFAM
Pfam:Pkinase 171 429 9e-55 PFAM
Pfam:OSR1_C 450 486 3e-18 PFAM
low complexity region 503 513 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 757 778 N/A INTRINSIC
low complexity region 793 808 N/A INTRINSIC
low complexity region 841 877 N/A INTRINSIC
low complexity region 882 915 N/A INTRINSIC
low complexity region 921 951 N/A INTRINSIC
low complexity region 1014 1033 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128735
Predicted Effect probably benign
Transcript: ENSMUST00000139487
SMART Domains Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 242 4e-8 PFAM
Pfam:Pkinase 171 252 1.9e-10 PFAM
low complexity region 269 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147741
SMART Domains Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase 171 394 9.3e-50 PFAM
Pfam:Pkinase_Tyr 171 399 3.7e-38 PFAM
low complexity region 401 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168089
SMART Domains Protein: ENSMUSP00000130367
Gene: ENSMUSG00000017188

DomainStartEndE-ValueType
Pfam:Coiled-coil_56 1 74 2.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170056
SMART Domains Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
Pfam:OSR1_C 13 49 8.6e-20 PFAM
low complexity region 66 76 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170372
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Wnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wnk4 APN 11 101268748 missense possibly damaging 0.47
IGL00535:Wnk4 APN 11 101264349 missense probably damaging 1.00
IGL01401:Wnk4 APN 11 101276683 splice site probably benign
IGL01931:Wnk4 APN 11 101268484 missense possibly damaging 0.94
IGL01977:Wnk4 APN 11 101265414 missense probably damaging 1.00
IGL02165:Wnk4 APN 11 101275291 unclassified probably benign
IGL02197:Wnk4 APN 11 101263957 missense probably damaging 1.00
IGL02457:Wnk4 APN 11 101269563 splice site probably benign
IGL02963:Wnk4 APN 11 101276213 unclassified probably benign
ashamed UTSW 11 101265431 missense probably damaging 1.00
Caught_dead UTSW 11 101264330 missense probably damaging 1.00
mortification UTSW 11 101263894 makesense probably null
R5181_Wnk4_561 UTSW 11 101265377 missense probably damaging 0.96
shame UTSW 11 101262856 missense probably damaging 1.00
R0066:Wnk4 UTSW 11 101265435 missense probably damaging 1.00
R0317:Wnk4 UTSW 11 101268804 missense probably benign 0.01
R0628:Wnk4 UTSW 11 101275023 missense probably benign 0.10
R0630:Wnk4 UTSW 11 101265386 missense probably damaging 1.00
R0710:Wnk4 UTSW 11 101274106 missense probably benign 0.22
R1290:Wnk4 UTSW 11 101276340 unclassified probably benign
R1482:Wnk4 UTSW 11 101269636 missense probably damaging 0.99
R1775:Wnk4 UTSW 11 101276340 unclassified probably benign
R2005:Wnk4 UTSW 11 101263890 missense probably damaging 1.00
R2258:Wnk4 UTSW 11 101275035 missense probably damaging 0.98
R2323:Wnk4 UTSW 11 101268481 missense probably damaging 0.99
R3081:Wnk4 UTSW 11 101276891 splice site probably benign
R3763:Wnk4 UTSW 11 101269288 missense probably benign 0.00
R4196:Wnk4 UTSW 11 101269631 missense probably damaging 1.00
R4447:Wnk4 UTSW 11 101268451 missense possibly damaging 0.65
R4614:Wnk4 UTSW 11 101274111 missense probably benign 0.00
R4751:Wnk4 UTSW 11 101276362 unclassified probably benign
R4948:Wnk4 UTSW 11 101268281 missense probably damaging 1.00
R5067:Wnk4 UTSW 11 101262856 missense probably damaging 1.00
R5073:Wnk4 UTSW 11 101261188 missense probably damaging 1.00
R5107:Wnk4 UTSW 11 101275538 unclassified probably benign
R5181:Wnk4 UTSW 11 101265377 missense probably damaging 0.96
R5205:Wnk4 UTSW 11 101265138 missense possibly damaging 0.89
R5252:Wnk4 UTSW 11 101268748 missense possibly damaging 0.47
R5273:Wnk4 UTSW 11 101263869 missense probably damaging 1.00
R5293:Wnk4 UTSW 11 101275197 unclassified probably benign
R5609:Wnk4 UTSW 11 101275636 unclassified probably benign
R5915:Wnk4 UTSW 11 101263894 makesense probably null
R5931:Wnk4 UTSW 11 101261221 missense probably damaging 0.99
R6126:Wnk4 UTSW 11 101276348 unclassified probably benign
R6164:Wnk4 UTSW 11 101275068 missense possibly damaging 0.56
R6191:Wnk4 UTSW 11 101264330 missense probably damaging 1.00
R6267:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R6274:Wnk4 UTSW 11 101265431 missense probably damaging 1.00
R6296:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R7132:Wnk4 UTSW 11 101261200 missense probably benign 0.22
R7251:Wnk4 UTSW 11 101265153 missense possibly damaging 0.70
R7352:Wnk4 UTSW 11 101264418 missense probably damaging 1.00
R7404:Wnk4 UTSW 11 101268492 critical splice donor site probably null
R7624:Wnk4 UTSW 11 101264354 nonsense probably null
R7634:Wnk4 UTSW 11 101262895 missense probably damaging 1.00
R7780:Wnk4 UTSW 11 101269577 missense probably damaging 0.96
R8006:Wnk4 UTSW 11 101268356 missense probably benign 0.00
R8046:Wnk4 UTSW 11 101274092 missense probably benign 0.20
R8143:Wnk4 UTSW 11 101262799 missense probably damaging 1.00
R8458:Wnk4 UTSW 11 101275321 nonsense probably null
R8735:Wnk4 UTSW 11 101276266 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTCCTCTGCCTAGCCTG -3'
(R):5'- GTCACTTGGAAACGGCCAAC -3'

Sequencing Primer
(F):5'- GCCTAGCCTGCCCCTTTC -3'
(R):5'- TTGGAAACGGCCAACAAGCTG -3'
Posted On2014-10-15