Incidental Mutation 'R2229:Zfp729b'
ID239624
Institutional Source Beutler Lab
Gene Symbol Zfp729b
Ensembl Gene ENSMUSG00000058093
Gene Namezinc finger protein 729b
SynonymsAA987161
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67589439-67609707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67595265 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 60 (I60M)
Ref Sequence ENSEMBL: ENSMUSP00000012873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012873] [ENSMUST00000138725] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably damaging
Transcript: ENSMUST00000012873
AA Change: I60M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000012873
Gene: ENSMUSG00000058093
AA Change: I60M

DomainStartEndE-ValueType
KRAB 5 65 1.63e-28 SMART
ZnF_C2H2 132 154 3.58e-2 SMART
PHD 133 194 1e1 SMART
ZnF_C2H2 160 182 3.21e-4 SMART
ZnF_C2H2 188 210 6.78e-3 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
PHD 217 278 7.77e0 SMART
ZnF_C2H2 244 266 6.67e-2 SMART
ZnF_C2H2 272 294 1.12e-3 SMART
ZnF_C2H2 300 322 1.79e-2 SMART
PHD 301 362 1.65e1 SMART
ZnF_C2H2 328 350 2.57e-3 SMART
ZnF_C2H2 356 378 2.43e-4 SMART
ZnF_C2H2 412 434 1.67e-2 SMART
ZnF_C2H2 440 462 1.28e-3 SMART
PHD 441 502 4.46e0 SMART
ZnF_C2H2 468 490 1.58e-3 SMART
ZnF_C2H2 496 518 2.95e-3 SMART
ZnF_C2H2 524 546 4.47e-3 SMART
PHD 525 586 5.77e0 SMART
ZnF_C2H2 552 574 5.42e-2 SMART
ZnF_C2H2 580 602 1.03e-2 SMART
ZnF_C2H2 608 630 5.5e-3 SMART
PHD 609 670 1.52e1 SMART
ZnF_C2H2 636 658 6.99e-5 SMART
ZnF_C2H2 664 686 3.34e-2 SMART
ZnF_C2H2 720 742 3.63e-3 SMART
PHD 721 782 2.67e0 SMART
ZnF_C2H2 748 770 5.42e-2 SMART
ZnF_C2H2 776 798 5.14e-3 SMART
ZnF_C2H2 804 826 4.17e-3 SMART
ZnF_C2H2 832 854 1.47e-3 SMART
PHD 833 894 4.93e0 SMART
ZnF_C2H2 860 882 3.83e-2 SMART
ZnF_C2H2 888 910 4.4e-2 SMART
ZnF_C2H2 916 938 7.78e-3 SMART
ZnF_C2H2 944 966 4.17e-3 SMART
ZnF_C2H2 972 994 1.38e-3 SMART
ZnF_C2H2 1000 1022 1.69e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133177
Predicted Effect probably damaging
Transcript: ENSMUST00000138725
AA Change: I70M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115783
Gene: ENSMUSG00000058093
AA Change: I70M

DomainStartEndE-ValueType
KRAB 15 75 1.63e-28 SMART
ZnF_C2H2 142 164 3.58e-2 SMART
ZnF_C2H2 170 192 3.21e-4 SMART
ZnF_C2H2 198 220 6.78e-3 SMART
ZnF_C2H2 226 248 3.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223599
Predicted Effect probably benign
Transcript: ENSMUST00000224814
AA Change: I70M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably damaging
Transcript: ENSMUST00000225627
AA Change: I70M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Other mutations in Zfp729b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Zfp729b APN 13 67595230 missense probably benign 0.09
IGL02852:Zfp729b APN 13 67592823 missense probably damaging 0.99
PIT4449001:Zfp729b UTSW 13 67591423 missense probably benign 0.01
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0238:Zfp729b UTSW 13 67591903 missense probably damaging 0.98
R0450:Zfp729b UTSW 13 67591134 missense probably benign
R0510:Zfp729b UTSW 13 67591134 missense probably benign
R1122:Zfp729b UTSW 13 67595284 missense possibly damaging 0.75
R1400:Zfp729b UTSW 13 67592794 missense possibly damaging 0.63
R1915:Zfp729b UTSW 13 67593220 missense probably damaging 1.00
R1929:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2270:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2271:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2344:Zfp729b UTSW 13 67592233 missense probably damaging 1.00
R2377:Zfp729b UTSW 13 67591701 missense possibly damaging 0.70
R2930:Zfp729b UTSW 13 67591854 missense probably benign
R3053:Zfp729b UTSW 13 67593466 missense probably damaging 1.00
R3404:Zfp729b UTSW 13 67591164 missense probably damaging 0.98
R4118:Zfp729b UTSW 13 67592710 missense possibly damaging 0.91
R4947:Zfp729b UTSW 13 67596672 missense probably damaging 1.00
R5408:Zfp729b UTSW 13 67591444 missense probably benign 0.18
R5511:Zfp729b UTSW 13 67592380 missense probably damaging 1.00
R5542:Zfp729b UTSW 13 67591021 missense probably benign
R5908:Zfp729b UTSW 13 67591255 missense probably benign 0.00
R5977:Zfp729b UTSW 13 67591621 missense probably benign 0.03
R5996:Zfp729b UTSW 13 67593858 missense probably benign 0.18
R7086:Zfp729b UTSW 13 67592937 missense probably damaging 0.99
R7146:Zfp729b UTSW 13 67593376 missense probably damaging 1.00
R7217:Zfp729b UTSW 13 67595248 missense probably damaging 0.96
R7332:Zfp729b UTSW 13 67609636 splice site probably null
R7472:Zfp729b UTSW 13 67593883 missense probably benign 0.00
R7615:Zfp729b UTSW 13 67591498 missense possibly damaging 0.77
R7639:Zfp729b UTSW 13 67591852 missense probably benign 0.02
R7652:Zfp729b UTSW 13 67591252 missense probably benign 0.00
R7738:Zfp729b UTSW 13 67592075 missense probably benign 0.00
R8137:Zfp729b UTSW 13 67592742 missense probably damaging 1.00
R8381:Zfp729b UTSW 13 67591498 missense possibly damaging 0.77
R8402:Zfp729b UTSW 13 67592577 missense probably damaging 1.00
X0023:Zfp729b UTSW 13 67592459 missense possibly damaging 0.95
X0028:Zfp729b UTSW 13 67592194 missense probably damaging 1.00
Z1088:Zfp729b UTSW 13 67593070 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTCCTGGAGAACACAAGTTAATC -3'
(R):5'- GTGCCCATCAGAAAACATGG -3'

Sequencing Primer
(F):5'- CAAAGCTTATGAGATTCAAAGCATCC -3'
(R):5'- TGGGAAAAATGAATCCTCTATATTCC -3'
Posted On2014-10-15