Incidental Mutation 'R2229:Eml4'
ID 239637
Institutional Source Beutler Lab
Gene Symbol Eml4
Ensembl Gene ENSMUSG00000032624
Gene Name echinoderm microtubule associated protein like 4
Synonyms 4930443C24Rik
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock # R2229 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 83350931-83480361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83451056 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 502 (P502S)
Ref Sequence ENSEMBL: ENSMUSP00000094528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049503] [ENSMUST00000096766] [ENSMUST00000112363]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000049503
AA Change: P390S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000041880
Gene: ENSMUSG00000032624
AA Change: P390S

coiled coil region 15 53 N/A INTRINSIC
WD40 197 246 1.79e-1 SMART
Blast:WD40 252 294 3e-19 BLAST
WD40 297 336 5.97e-1 SMART
WD40 345 382 2.96e1 SMART
low complexity region 388 396 N/A INTRINSIC
WD40 397 436 1.48e-2 SMART
WD40 480 519 4.95e-4 SMART
WD40 522 560 7.92e1 SMART
WD40 563 602 5.75e-1 SMART
WD40 609 648 2.69e-5 SMART
WD40 722 762 8.04e-4 SMART
low complexity region 793 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096766
AA Change: P502S

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000094528
Gene: ENSMUSG00000032624
AA Change: P502S

coiled coil region 15 53 N/A INTRINSIC
low complexity region 137 155 N/A INTRINSIC
Pfam:HELP 236 308 1.1e-33 PFAM
WD40 309 358 1.79e-1 SMART
Blast:WD40 364 406 4e-20 BLAST
WD40 409 448 5.97e-1 SMART
WD40 457 494 2.96e1 SMART
low complexity region 500 508 N/A INTRINSIC
WD40 509 548 1.48e-2 SMART
WD40 592 631 4.95e-4 SMART
WD40 634 672 7.92e1 SMART
WD40 675 714 5.75e-1 SMART
WD40 721 760 2.69e-5 SMART
WD40 834 874 8.04e-4 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112363
AA Change: P433S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107982
Gene: ENSMUSG00000032624
AA Change: P433S

coiled coil region 15 53 N/A INTRINSIC
WD40 240 289 1.79e-1 SMART
Blast:WD40 295 337 3e-19 BLAST
WD40 340 379 5.97e-1 SMART
WD40 388 425 2.96e1 SMART
low complexity region 431 439 N/A INTRINSIC
WD40 440 479 1.48e-2 SMART
WD40 523 562 4.95e-4 SMART
WD40 565 603 7.92e1 SMART
WD40 606 645 5.75e-1 SMART
WD40 652 691 2.69e-5 SMART
WD40 765 805 8.04e-4 SMART
low complexity region 836 848 N/A INTRINSIC
Meta Mutation Damage Score 0.0623 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the echinoderm microtubule associated protein-like family. The encoded WD-repeat protein may be involved in microtubule formation. Abnormal fusion of parts of this gene with portions of the anaplastic lymphoma receptor tyrosine kinase gene, which generates EML4-ALK fusion transcripts, is one of the primary mutations associated with non-small cell lung cancer. Alternative splicing of this gene results in two transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Eml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Eml4 APN 17 83448184 missense probably benign 0.05
IGL00815:Eml4 APN 17 83450790 splice site probably benign
IGL01969:Eml4 APN 17 83445980 missense possibly damaging 0.95
IGL02005:Eml4 APN 17 83477703 splice site probably benign
IGL02273:Eml4 APN 17 83456379 splice site probably null
IGL02318:Eml4 APN 17 83441366 missense probably benign 0.01
IGL02421:Eml4 APN 17 83477892 missense probably benign 0.00
IGL02728:Eml4 APN 17 83473139 splice site probably null
IGL02814:Eml4 APN 17 83441362 nonsense probably null
IGL02900:Eml4 APN 17 83477992 missense probably benign 0.00
IGL03205:Eml4 APN 17 83454444 missense probably damaging 1.00
erring UTSW 17 83448217 missense probably damaging 1.00
R0147:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0148:Eml4 UTSW 17 83421652 missense probably damaging 1.00
R0440:Eml4 UTSW 17 83446058 critical splice donor site probably null
R0541:Eml4 UTSW 17 83440042 missense probably benign 0.00
R0645:Eml4 UTSW 17 83463493 splice site probably benign
R0733:Eml4 UTSW 17 83454464 missense possibly damaging 0.88
R0944:Eml4 UTSW 17 83478060 missense probably benign 0.08
R1071:Eml4 UTSW 17 83478039 nonsense probably null
R1975:Eml4 UTSW 17 83410193 missense probably benign 0.00
R2042:Eml4 UTSW 17 83448178 missense probably damaging 0.97
R2257:Eml4 UTSW 17 83477760 missense probably damaging 0.99
R2878:Eml4 UTSW 17 83410174 missense probably benign 0.01
R3820:Eml4 UTSW 17 83473065 missense probably damaging 1.00
R4466:Eml4 UTSW 17 83421674 nonsense probably null
R4620:Eml4 UTSW 17 83461533 missense probably benign 0.13
R4657:Eml4 UTSW 17 83450948 nonsense probably null
R4717:Eml4 UTSW 17 83448225 missense probably benign 0.38
R4740:Eml4 UTSW 17 83410030 missense probably damaging 1.00
R5073:Eml4 UTSW 17 83463577 missense probably damaging 1.00
R5699:Eml4 UTSW 17 83410085 missense probably benign 0.16
R5834:Eml4 UTSW 17 83477741 missense probably damaging 1.00
R5944:Eml4 UTSW 17 83446043 missense possibly damaging 0.52
R6044:Eml4 UTSW 17 83445950 missense probably damaging 1.00
R6378:Eml4 UTSW 17 83448217 missense probably damaging 1.00
R6980:Eml4 UTSW 17 83451017 missense probably benign 0.00
R7025:Eml4 UTSW 17 83425311 missense probably benign 0.04
R7037:Eml4 UTSW 17 83425327 missense probably benign 0.04
R7042:Eml4 UTSW 17 83461570 missense probably damaging 0.99
R7192:Eml4 UTSW 17 83454461 missense probably benign 0.01
R7525:Eml4 UTSW 17 83445950 missense probably damaging 1.00
R7548:Eml4 UTSW 17 83425337 missense probably benign 0.18
R7595:Eml4 UTSW 17 83456084 missense probably benign 0.18
R7791:Eml4 UTSW 17 83473706 missense probably benign 0.45
R7866:Eml4 UTSW 17 83450697 missense probably benign 0.00
R7936:Eml4 UTSW 17 83473686 missense possibly damaging 0.65
R8435:Eml4 UTSW 17 83421641 missense possibly damaging 0.78
R8447:Eml4 UTSW 17 83448227 missense probably damaging 0.99
R8698:Eml4 UTSW 17 83477916 missense probably benign
R9026:Eml4 UTSW 17 83457050 missense probably damaging 0.99
R9054:Eml4 UTSW 17 83427211 splice site probably benign
R9630:Eml4 UTSW 17 83410143 missense probably damaging 1.00
R9765:Eml4 UTSW 17 83440069 missense probably damaging 1.00
Z1176:Eml4 UTSW 17 83445965 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-15