Incidental Mutation 'R2229:Prpf19'
ID 239642
Institutional Source Beutler Lab
Gene Symbol Prpf19
Ensembl Gene ENSMUSG00000024735
Gene Name pre-mRNA processing factor 19
Synonyms D19Wsu55e, Snev, Prp19, PSO4
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2229 (G1)
Quality Score 207
Status Validated
Chromosome 19
Chromosomal Location 10895231-10909559 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10897598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 39 (T39A)
Ref Sequence ENSEMBL: ENSMUSP00000136858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025642] [ENSMUST00000179297]
AlphaFold Q99KP6
Predicted Effect probably benign
Transcript: ENSMUST00000025642
AA Change: T39A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025642
Gene: ENSMUSG00000024735
AA Change: T39A

Ubox 2 68 3.65e-29 SMART
Pfam:Prp19 94 154 1.5e-25 PFAM
WD40 225 269 4.62e-1 SMART
WD40 272 311 6.32e-11 SMART
WD40 314 353 1.31e-3 SMART
WD40 356 397 2.65e-4 SMART
WD40 400 439 7.79e-11 SMART
WD40 442 482 5.92e1 SMART
WD40 483 522 4.48e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178868
SMART Domains Protein: ENSMUSP00000137435
Gene: ENSMUSG00000024735

Pfam:Prp19 1 50 7.9e-23 PFAM
WD40 121 165 4.62e-1 SMART
WD40 168 207 6.32e-11 SMART
WD40 210 249 1.31e-3 SMART
WD40 252 293 2.65e-4 SMART
WD40 296 335 7.79e-11 SMART
WD40 338 378 5.92e1 SMART
WD40 379 418 4.48e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179297
AA Change: T39A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136858
Gene: ENSMUSG00000024735
AA Change: T39A

Ubox 2 68 2.43e-25 SMART
Pfam:Prp19 95 153 1.3e-26 PFAM
WD40 225 269 4.62e-1 SMART
WD40 272 311 6.32e-11 SMART
WD40 314 353 1.31e-3 SMART
WD40 356 397 2.65e-4 SMART
WD40 400 439 7.79e-11 SMART
WD40 442 482 5.92e1 SMART
WD40 483 522 4.48e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191552
Meta Mutation Damage Score 0.1026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PSO4 is the human homolog of yeast Pso4, a gene essential for cell survival and DNA repair (Beck et al., 2008 [PubMed 18263876]).[supplied by OMIM, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation and have defective cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp1r3c C A 19: 36,733,698 R224L probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Prpf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Prpf19 APN 19 10900203 missense probably damaging 0.99
IGL01395:Prpf19 APN 19 10901011 missense probably damaging 0.98
IGL02111:Prpf19 APN 19 10905094 missense probably benign
IGL02163:Prpf19 APN 19 10902436 missense probably benign 0.07
IGL02653:Prpf19 APN 19 10902964 splice site probably benign
bojan UTSW 19 10897790 intron probably benign
R0179:Prpf19 UTSW 19 10897808 splice site probably benign
R1503:Prpf19 UTSW 19 10901022 missense possibly damaging 0.65
R1856:Prpf19 UTSW 19 10902416 missense probably damaging 0.96
R4755:Prpf19 UTSW 19 10897790 intron probably benign
R4882:Prpf19 UTSW 19 10898959 intron probably benign
R4972:Prpf19 UTSW 19 10899345 intron probably benign
R5110:Prpf19 UTSW 19 10899287 splice site probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-10-15