Incidental Mutation 'R2229:Ppp1r3c'
ID239644
Institutional Source Beutler Lab
Gene Symbol Ppp1r3c
Ensembl Gene ENSMUSG00000067279
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3C
Synonymsprotein targeting to glicogen, Ppp1r5, PTG
MMRRC Submission 040230-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2229 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36731737-36736653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36733698 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 224 (R224L)
Ref Sequence ENSEMBL: ENSMUSP00000084578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087321]
Predicted Effect probably benign
Transcript: ENSMUST00000087321
AA Change: R224L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084578
Gene: ENSMUSG00000067279
AA Change: R224L

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
Pfam:CBM_21 151 257 5.5e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carbohydrate binding protein that is a subunit of the protein phosphatase 1 (PP1) complex. PP1 catalyzes reversible protein phosphorylation, which is important in a wide range of cellular activities. The encoded protein affects glycogen biosynthesis by activating glycogen synthase and limiting glycogen breakdown by reducing glycogen phosphorylase activity. DNA hypermethylation of this gene has been found in colorectal cancer patients. The encoded protein also interacts with the laforin protein, which is a protein tyrosine phosphatase implicated in Lafora disease. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice are embyronic lethal. Heterozygotes have reduced glycogen stores, attenuated glycogen synthesis, glucose intolerance, hyperinsulinemia and insulin resistance. Mice homozygous for a different knock-out allele exhibit normal lifespan with enhanced whole body insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A T 8: 40,680,365 I291L probably benign Het
Adcy8 C A 15: 64,822,207 R407L possibly damaging Het
Adgb A T 10: 10,436,051 V212E probably damaging Het
Adgrg7 C T 16: 56,752,403 S350N probably benign Het
Agbl1 A G 7: 76,433,378 T448A probably benign Het
Aldh1l1 C G 6: 90,583,186 T605R probably damaging Het
Arfip1 A T 3: 84,547,973 N18K probably damaging Het
Atp6v1b2 C A 8: 69,102,759 probably null Het
Banp G A 8: 121,978,685 S98N probably damaging Het
Btnl9 T C 11: 49,169,118 D601G probably damaging Het
C9 T C 15: 6,445,420 I20T possibly damaging Het
Cacna1b A G 2: 24,685,804 V744A probably damaging Het
Catsper3 A G 13: 55,808,054 E311G probably damaging Het
Ccdc180 G T 4: 45,948,856 probably null Het
Cdc5l A G 17: 45,407,846 Y615H probably benign Het
Crybg2 TGGAGGAGGAGGAGGAGGAG TGGAGGAGGAGGAGGAG 4: 134,074,526 probably benign Het
Eml4 C T 17: 83,451,056 P502S probably benign Het
Fsip1 T C 2: 118,222,444 E367G probably benign Het
Gja3 T C 14: 57,036,714 D67G probably damaging Het
Gm4894 T C 9: 49,274,190 probably benign Het
Gm7853 A G 14: 36,089,527 noncoding transcript Het
Gmps T G 3: 64,014,263 Y562* probably null Het
Golga2 C A 2: 32,306,465 P976T probably benign Het
Gpr182 T A 10: 127,750,141 I314F possibly damaging Het
Gprc6a A G 10: 51,626,795 V324A possibly damaging Het
Gykl1 A G 18: 52,695,267 T516A probably benign Het
Hist2h2ab T C 3: 96,220,106 L64P possibly damaging Het
Ifit1bl2 G T 19: 34,619,230 L329M possibly damaging Het
Igsf9b T C 9: 27,333,496 S920P probably damaging Het
Kif3c T A 12: 3,366,671 S231T probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lmnb2 T C 10: 80,904,392 probably benign Het
Lrrc69 T C 4: 14,773,694 S121G probably benign Het
Mppe1 A G 18: 67,228,011 probably null Het
Muc5b T A 7: 141,861,644 C2776S possibly damaging Het
Myh8 T G 11: 67,308,348 N1893K probably damaging Het
Myo7a T C 7: 98,054,910 T1932A probably benign Het
Nbn A G 4: 15,970,904 T296A probably benign Het
Nckap1l T C 15: 103,455,934 probably null Het
Nek5 A T 8: 22,113,632 N151K possibly damaging Het
Nup93 C T 8: 94,304,191 T305I probably benign Het
Oca2 T A 7: 56,357,155 H663Q probably benign Het
Optn T A 2: 5,024,117 H525L probably damaging Het
Pdzph1 A G 17: 58,932,412 probably benign Het
Pikfyve A G 1: 65,267,855 K1801E probably damaging Het
Pkd2l2 G A 18: 34,430,329 V478M probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prpf19 A G 19: 10,897,598 T39A probably benign Het
Pwwp2b T C 7: 139,255,188 C182R probably damaging Het
Rcan3 T C 4: 135,425,377 D11G probably benign Het
Rgsl1 C A 1: 153,822,358 W482L possibly damaging Het
Sfxn4 C T 19: 60,851,020 G200E probably damaging Het
Slc4a8 T C 15: 100,809,299 I848T probably damaging Het
Slc7a13 T C 4: 19,839,399 V334A probably benign Het
Smarcc2 A G 10: 128,488,341 probably benign Het
Spata18 A T 5: 73,666,901 I156L possibly damaging Het
Spats2 T C 15: 99,174,453 probably null Het
Tas2r104 G A 6: 131,685,132 H205Y probably damaging Het
Tcof1 A G 18: 60,832,177 probably benign Het
Tex15 C A 8: 33,571,237 H232N probably benign Het
Tg A T 15: 66,674,011 Q194L probably damaging Het
Tnfrsf22 C T 7: 143,644,776 probably null Het
Trim25 T A 11: 89,016,621 V602E probably damaging Het
Ttll9 A G 2: 152,983,063 E54G probably damaging Het
Ttn T C 2: 76,729,324 T29578A probably damaging Het
Tubgcp5 A G 7: 55,830,881 Q960R probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp13 A G 3: 32,917,551 I727V probably benign Het
Vmn2r67 T A 7: 85,152,042 I229F probably benign Het
Vmn2r92 A C 17: 18,167,392 I220L probably benign Het
Wnk4 T A 11: 101,275,641 probably benign Het
Wwp1 A T 4: 19,641,745 Y437N probably damaging Het
Zdhhc5 A G 2: 84,690,213 I540T probably damaging Het
Zfp729b T C 13: 67,595,265 I60M probably damaging Het
Other mutations in Ppp1r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ppp1r3c APN 19 36734103 missense probably damaging 1.00
IGL00486:Ppp1r3c APN 19 36733924 missense probably damaging 1.00
IGL01865:Ppp1r3c APN 19 36734178 missense probably benign 0.00
IGL02896:Ppp1r3c APN 19 36733465 missense probably benign 0.26
R0110:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0450:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0456:Ppp1r3c UTSW 19 36733891 nonsense probably null
R0469:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R1539:Ppp1r3c UTSW 19 36733961 missense probably benign
R1859:Ppp1r3c UTSW 19 36733611 missense probably damaging 1.00
R2228:Ppp1r3c UTSW 19 36733698 missense probably benign
R4534:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4535:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4619:Ppp1r3c UTSW 19 36734343 missense possibly damaging 0.94
R4630:Ppp1r3c UTSW 19 36733515 missense probably benign 0.02
R6015:Ppp1r3c UTSW 19 36733806 missense probably damaging 1.00
R8206:Ppp1r3c UTSW 19 36733446 missense probably benign 0.10
R8386:Ppp1r3c UTSW 19 36733938 missense probably damaging 1.00
Z1177:Ppp1r3c UTSW 19 36733918 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAGACTGTGGGCTCTATCTCAGTC -3'
(R):5'- GCCTCGAGAACTGCTCTTTG -3'

Sequencing Primer
(F):5'- TATCTCAGTCTTAGGGGGCCC -3'
(R):5'- CTTTGCAAGATCGGACGGTGAC -3'
Posted On2014-10-15