Mutagenetix > Incidental Mutations

Incidental Mutation 'R2229:Sfxn4'

239645

Institutional Source

Beutler Lab

Gene Symbol

Sfxn4

Ensembl Gene

ENSMUSG00000063698

Gene Name

sideroflexin 4

Synonyms

MMRRC Submission

040230-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2229 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60837277-60861479 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60851020 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 200 (G200E)

Ref Sequence

ENSEMBL: ENSMUSP00000118743 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080806] [ENSMUST00000124921] [ENSMUST00000135808]

Predicted Effect

probably benign
Transcript: ENSMUST00000080806

Predicted Effect

probably benign
Transcript: ENSMUST00000124921

Predicted Effect

probably damaging
Transcript: ENSMUST00000135808
AA Change: G200E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118743
Gene: ENSMUSG00000063698
AA Change: G200E

Domain	Start	End	E-Value	Type
Pfam:Mtc	11	313	2.1e-67	PFAM

Meta Mutation Damage Score

0.9087

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sideroflexin family. The encoded protein is a transmembrane protein of the inner mitochondrial membrane, and is required for mitochondrial respiratory homeostasis and erythropoiesis. Mutations in this gene are associated with mitochondriopathy and macrocytic anemia. Alternatively spliced transcript variants have been found in this gene. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam24	A	T	8: 40,680,365	I291L	probably benign	Het
Adcy8	C	A	15: 64,822,207	R407L	possibly damaging	Het
Adgb	A	T	10: 10,436,051	V212E	probably damaging	Het
Adgrg7	C	T	16: 56,752,403	S350N	probably benign	Het
Agbl1	A	G	7: 76,433,378	T448A	probably benign	Het
Aldh1l1	C	G	6: 90,583,186	T605R	probably damaging	Het
Arfip1	A	T	3: 84,547,973	N18K	probably damaging	Het
Atp6v1b2	C	A	8: 69,102,759		probably null	Het
Banp	G	A	8: 121,978,685	S98N	probably damaging	Het
Btnl9	T	C	11: 49,169,118	D601G	probably damaging	Het
C9	T	C	15: 6,445,420	I20T	possibly damaging	Het
Cacna1b	A	G	2: 24,685,804	V744A	probably damaging	Het
Catsper3	A	G	13: 55,808,054	E311G	probably damaging	Het
Ccdc180	G	T	4: 45,948,856		probably null	Het
Cdc5l	A	G	17: 45,407,846	Y615H	probably benign	Het
Crybg2	TGGAGGAGGAGGAGGAGGAG	TGGAGGAGGAGGAGGAG	4: 134,074,526		probably benign	Het
Eml4	C	T	17: 83,451,056	P502S	probably benign	Het
Fsip1	T	C	2: 118,222,444	E367G	probably benign	Het
Gja3	T	C	14: 57,036,714	D67G	probably damaging	Het
Gm4894	T	C	9: 49,274,190		probably benign	Het
Gm7853	A	G	14: 36,089,527		noncoding transcript	Het
Gmps	T	G	3: 64,014,263	Y562*	probably null	Het
Golga2	C	A	2: 32,306,465	P976T	probably benign	Het
Gpr182	T	A	10: 127,750,141	I314F	possibly damaging	Het
Gprc6a	A	G	10: 51,626,795	V324A	possibly damaging	Het
Gykl1	A	G	18: 52,695,267	T516A	probably benign	Het
Hist2h2ab	T	C	3: 96,220,106	L64P	possibly damaging	Het
Ifit1bl2	G	T	19: 34,619,230	L329M	possibly damaging	Het
Igsf9b	T	C	9: 27,333,496	S920P	probably damaging	Het
Kif3c	T	A	12: 3,366,671	S231T	probably benign	Het
Kpna7	A	T	5: 144,989,697	Y482N	probably damaging	Het
Lmnb2	T	C	10: 80,904,392		probably benign	Het
Lrrc69	T	C	4: 14,773,694	S121G	probably benign	Het
Mppe1	A	G	18: 67,228,011		probably null	Het
Muc5b	T	A	7: 141,861,644	C2776S	possibly damaging	Het
Myh8	T	G	11: 67,308,348	N1893K	probably damaging	Het
Myo7a	T	C	7: 98,054,910	T1932A	probably benign	Het
Nbn	A	G	4: 15,970,904	T296A	probably benign	Het
Nckap1l	T	C	15: 103,455,934		probably null	Het
Nek5	A	T	8: 22,113,632	N151K	possibly damaging	Het
Nup93	C	T	8: 94,304,191	T305I	probably benign	Het
Oca2	T	A	7: 56,357,155	H663Q	probably benign	Het
Optn	T	A	2: 5,024,117	H525L	probably damaging	Het
Pdzph1	A	G	17: 58,932,412		probably benign	Het
Pikfyve	A	G	1: 65,267,855	K1801E	probably damaging	Het
Pkd2l2	G	A	18: 34,430,329	V478M	probably damaging	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Ppp1r3c	C	A	19: 36,733,698	R224L	probably benign	Het
Prpf19	A	G	19: 10,897,598	T39A	probably benign	Het
Pwwp2b	T	C	7: 139,255,188	C182R	probably damaging	Het
Rcan3	T	C	4: 135,425,377	D11G	probably benign	Het
Rgsl1	C	A	1: 153,822,358	W482L	possibly damaging	Het
Slc4a8	T	C	15: 100,809,299	I848T	probably damaging	Het
Slc7a13	T	C	4: 19,839,399	V334A	probably benign	Het
Smarcc2	A	G	10: 128,488,341		probably benign	Het
Spata18	A	T	5: 73,666,901	I156L	possibly damaging	Het
Spats2	T	C	15: 99,174,453		probably null	Het
Tas2r104	G	A	6: 131,685,132	H205Y	probably damaging	Het
Tcof1	A	G	18: 60,832,177		probably benign	Het
Tex15	C	A	8: 33,571,237	H232N	probably benign	Het
Tg	A	T	15: 66,674,011	Q194L	probably damaging	Het
Tnfrsf22	C	T	7: 143,644,776		probably null	Het
Trim25	T	A	11: 89,016,621	V602E	probably damaging	Het
Ttll9	A	G	2: 152,983,063	E54G	probably damaging	Het
Ttn	T	C	2: 76,729,324	T29578A	probably damaging	Het
Tubgcp5	A	G	7: 55,830,881	Q960R	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp13	A	G	3: 32,917,551	I727V	probably benign	Het
Vmn2r67	T	A	7: 85,152,042	I229F	probably benign	Het
Vmn2r92	A	C	17: 18,167,392	I220L	probably benign	Het
Wnk4	T	A	11: 101,275,641		probably benign	Het
Wwp1	A	T	4: 19,641,745	Y437N	probably damaging	Het
Zdhhc5	A	G	2: 84,690,213	I540T	probably damaging	Het
Zfp729b	T	C	13: 67,595,265	I60M	probably damaging	Het

Other mutations in Sfxn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01141:Sfxn4	APN	19	60851014	missense	possibly damaging	0.91
IGL01567:Sfxn4	APN	19	60853898	missense	probably damaging	1.00
IGL01829:Sfxn4	APN	19	60858734	missense	probably damaging	1.00
IGL01903:Sfxn4	APN	19	60858680	missense	probably damaging	0.99
IGL01965:Sfxn4	APN	19	60858744	splice site	probably benign
IGL03290:Sfxn4	APN	19	60860070	missense	probably damaging	1.00
R0346:Sfxn4	UTSW	19	60858673	missense	probably benign	0.01
R0550:Sfxn4	UTSW	19	60850945	splice site	probably benign
R2228:Sfxn4	UTSW	19	60851020	missense	probably damaging	1.00
R3949:Sfxn4	UTSW	19	60852063	missense	probably damaging	1.00
R5074:Sfxn4	UTSW	19	60851012	missense	probably damaging	1.00
R6534:Sfxn4	UTSW	19	60839023	missense	probably damaging	1.00
R7120:Sfxn4	UTSW	19	60852039	nonsense	probably null
R7375:Sfxn4	UTSW	19	60858674	missense	probably benign	0.38
R7438:Sfxn4	UTSW	19	60857361	missense	probably damaging	0.99
R7440:Sfxn4	UTSW	19	60842204	missense	possibly damaging	0.92
R7479:Sfxn4	UTSW	19	60858674	missense	possibly damaging	0.74
R7577:Sfxn4	UTSW	19	60853886	missense	probably benign	0.21
R7883:Sfxn4	UTSW	19	60858749	splice site	probably null
R8058:Sfxn4	UTSW	19	60844252	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGACACTAGGTTACAAGTTCTC -3'
(R):5'- GCCCATAGCAGGTGAGTATCTG -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- CCATAGCAGGTGAGTATCTGAGAGTC -3'

Posted On

2014-10-15