Incidental Mutation 'R2225:Zfp451'
ID239646
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
MMRRC Submission 040226-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2225 (G1)
Quality Score209
Status Validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 33770907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000139143]
Predicted Effect probably benign
Transcript: ENSMUST00000019861
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I2071T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Itih1 A G 14: 30,929,577 V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rnf185 T C 11: 3,432,445 D44G probably damaging Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 A G 7: 46,665,174 probably null Het
Wiz C T 17: 32,356,925 V836M probably damaging Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 splice site probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4617:Zfp451 UTSW 1 33802671 intron probably benign
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R4964:Zfp451 UTSW 1 33777861 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense possibly damaging 0.96
R7082:Zfp451 UTSW 1 33772891 critical splice donor site probably null
R7123:Zfp451 UTSW 1 33776869 missense probably damaging 1.00
R7149:Zfp451 UTSW 1 33777324 missense probably damaging 1.00
R7179:Zfp451 UTSW 1 33802570 missense unknown
R7185:Zfp451 UTSW 1 33769893 missense probably damaging 1.00
R7228:Zfp451 UTSW 1 33803394 missense unknown
R7402:Zfp451 UTSW 1 33813762 missense probably benign
R7462:Zfp451 UTSW 1 33777013 missense probably damaging 1.00
R7488:Zfp451 UTSW 1 33779140 missense probably benign 0.22
R7507:Zfp451 UTSW 1 33769759 missense probably damaging 1.00
R7774:Zfp451 UTSW 1 33805393 missense probably benign 0.20
R7835:Zfp451 UTSW 1 33772979 missense probably damaging 1.00
R7979:Zfp451 UTSW 1 33782138 missense probably benign 0.01
R8123:Zfp451 UTSW 1 33762167 missense possibly damaging 0.92
R8137:Zfp451 UTSW 1 33782075 missense possibly damaging 0.57
RF005:Zfp451 UTSW 1 33776792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGCAGACACATAGAGCTTGAC -3'
(R):5'- TGTTCCAGGACTGAGATAGCATG -3'

Sequencing Primer
(F):5'- GACACATAGAGCTTGACATCAGTC -3'
(R):5'- ATGCGTATGAACTACCAGGCCTG -3'
Posted On2014-10-15