Incidental Mutation 'R2225:Tnn'
ID239649
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission 040226-MU
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R2225 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 160147465 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 131 (C131S)
Ref Sequence ENSEMBL: ENSMUSP00000115685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039178
AA Change: C131S

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: C131S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: C131S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: C131S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.2983 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Aen C A 7: 78,902,451 T15K probably benign Het
Aggf1 A G 13: 95,370,846 S144P probably damaging Het
Akap9 A T 5: 4,077,271 R3706S probably damaging Het
Btd A G 14: 31,667,060 D246G probably benign Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Cep152 T C 2: 125,581,784 E899G probably damaging Het
Cpsf6 A T 10: 117,363,036 probably benign Het
Crybg3 A G 16: 59,554,678 I2071T probably damaging Het
Cwc22 T A 2: 77,908,151 probably benign Het
Ddah2 T A 17: 35,060,211 I16N probably damaging Het
Dld T G 12: 31,341,449 M123L probably benign Het
Eif5b A T 1: 38,019,223 K202I unknown Het
Gm6430 T C 1: 97,025,716 noncoding transcript Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Hspa4 C T 11: 53,286,933 V117M probably benign Het
Htra4 T C 8: 25,025,720 D434G probably benign Het
Itgb3 A G 11: 104,665,510 M726V probably benign Het
Itih1 A G 14: 30,929,577 V886A possibly damaging Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Limk1 G T 5: 134,661,556 probably null Het
Lonrf1 T C 8: 36,236,098 D308G probably damaging Het
Muc4 A T 16: 32,755,891 probably benign Het
Muc4 G A 16: 32,766,942 C2719Y possibly damaging Het
Mvb12b G A 2: 33,840,199 T60I possibly damaging Het
Myh2 C T 11: 67,193,729 T1698M probably benign Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Nkpd1 A T 7: 19,519,820 Y37F probably benign Het
Olfr167 T C 16: 19,515,246 H130R probably benign Het
Olfr952 T C 9: 39,426,619 I151V probably benign Het
Olfr975 T C 9: 39,950,537 K78R possibly damaging Het
Plekhg2 G A 7: 28,360,335 P1190S probably benign Het
Reck A G 4: 43,922,837 T371A probably benign Het
Rnf185 T C 11: 3,432,445 D44G probably damaging Het
Rpgrip1l T C 8: 91,221,467 E1196G probably benign Het
Rundc1 A G 11: 101,431,344 probably benign Het
Sf3b3 T C 8: 110,814,573 Y970C probably damaging Het
Sfxn1 A G 13: 54,085,517 T20A possibly damaging Het
Shprh T C 10: 11,162,235 probably benign Het
Spata31d1a T A 13: 59,703,715 I200L probably benign Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tbxa2r A G 10: 81,333,149 Y224C probably benign Het
Tlr5 A G 1: 182,972,376 probably benign Het
Tmem270 A G 5: 134,906,638 L21P probably damaging Het
Tmtc2 T C 10: 105,370,357 E359G probably benign Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 A G 7: 46,665,174 probably null Het
Wiz C T 17: 32,356,925 V836M probably damaging Het
Zfp451 T A 1: 33,770,907 probably benign Het
Zfp738 A G 13: 67,670,312 F520S probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 synonymous probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCACTCATTGTCACCTGG -3'
(R):5'- TGGGACATCACTCTTGGCTC -3'

Sequencing Primer
(F):5'- CCATGTTCTTAAACTGTAGAGCTG -3'
(R):5'- ATCACTCTTGGCTCCCGGG -3'
Posted On2014-10-15